Skip to main content

Table 1 Primers for real-time qPCR: primers for miRNA

From: Effect of β-hydroxy-β-methylbutyrate on miRNA expression in differentiating equine satellite cells exposed to hydrogen peroxide

No. Primer’s name Target sequence Amplification time and temperature
1 miR-146a-5p UGAGAACUGAAUUCCAUGGGUU 10 s/95 °C and 60 s/60 °C
2 miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 10 s/95 °C and 60 s/60 °C
3 miR-204b UUCCCUUUGUCAUCCUAUGCCU 10 s/95 °C and 60 s/60 °C
4 miR-208b AUAAGACGAACAAAAGGUUUGU 10 s/95 °C and 60 s/60 °C
5 miR-222 AGCUACAUCUGGCUACUGGGU 10 s/95 °C and 60 s/60 °C
6 miR-675 UGGUGCGGAGAGGGCCCACAGUG 10 s/95 °C and 60 s/60 °C