Table 1 Primers for real-time qPCR: primers for miRNA
No. | Primer’s name | Target sequence | Amplification time and temperature |
|---|---|---|---|
1 | miR-146a-5p | UGAGAACUGAAUUCCAUGGGUU | 10 s/95 °C and 60 s/60 °C |
2 | miR-146b-5p | UGAGAACUGAAUUCCAUAGGCU | 10 s/95 °C and 60 s/60 °C |
3 | miR-204b | UUCCCUUUGUCAUCCUAUGCCU | 10 s/95 °C and 60 s/60 °C |
4 | miR-208b | AUAAGACGAACAAAAGGUUUGU | 10 s/95 °C and 60 s/60 °C |
5 | miR-222 | AGCUACAUCUGGCUACUGGGU | 10 s/95 °C and 60 s/60 °C |
6 | miR-675 | UGGUGCGGAGAGGGCCCACAGUG | 10 s/95 °C and 60 s/60 °C |