Skip to main content

Table 2 Primers for real-time qPCR: primers for mRNA

From: Effect of β-hydroxy-β-methylbutyrate on miRNA expression in differentiating equine satellite cells exposed to hydrogen peroxide

No. Primer’s name Forward sequence Reverse sequence Annealing time and temperature
1 otud4 CCACCTCCTGCAGAACAAAAG GGGTCTTGGTAAAGGCTCATT 15 s/60 °C
2 cx43 (gja1) TGCTGCGAACCTACATCATC CGATGACGTTCAAGGCAAGA 15 s/60 °C
3 sod2 GTCACCGAGGAGAAGTACCA CTGGTTAGGACAGGCAACAA 15 s/60 °C
4 sod1 GATTCCACGTCCACGAGTTT CCCGAGAGTGAGATCACAGA 15 s/60 °C
5 tgfb2 AGTACTACGCCAAGGAGGTT TAGGCGGGATGGCATTTTCC 15 s/60 °C
6 myf5 GGAGACGCCTGAAGAAAGTC CCGGCAGGCTGTAGTAATTC 15 s/60 °C
7 bdnf CCCCATGAAAGAAGCAAACG TACAAGTCCGCGTCCTTACT 15 s/60 °C
8 gapdh GTTTGTGATGGGCGTGAACC GTCTTCTGGGTGGCAGTGAT 15 s/60 °C