Skip to main content

Table 1 The sequences of lncRNA Smart Silencer for mouse TCONS_00230836

From: TCONS_00230836 silencing restores stearic acid-induced β cell dysfunction through alleviating endoplasmic reticulum stress rather than apoptosis

Gene Sequences
siRNA-1 target sequence CCTTAATCCCAACCCTCAA
siRNA-2 target sequence TAGACATAGCCACATGAAA
siRNA-3 target sequence CCCAATAGTTAATGACAGA
Antisense oligonucleotides target sequence-1 GCTGTCAAAAAGGAATCACA
Antisense oligonucleotides target sequence-2 GGAAATGCAGTGTAGTAGAA
Antisense oligonucleotides target sequence-3 ATGGGCCCACCCTCTAAGAT