Skip to main content

Table 2 Primer sequences used for qRT-PCR

From: TCONS_00230836 silencing restores stearic acid-induced β cell dysfunction through alleviating endoplasmic reticulum stress rather than apoptosis

Gene   sequences (5′ to 3′)
TCONS_00230836 Forward AACCACAGGCTTCGGGATAGTC
  Reverse CAAGCATAACAGGCGGGAAGTC
ENSMUST00000074898 Forward ACCTTAAACGACGAGAAGCAATGG
  Reverse AGCCAGACACGTAGCCCACACG
ENSMUST00000086399 Forward TGGTCACCGTTGTGATCCC
  Reverse TGAGGTCCTCCTTGCATG
ENSMUST00000050785 Forward CTGTCTGTCTGCCACTCCAT
  Reverse GCTGGCCAAATAAGAAGAGG
ENSMUST00000124100 Forward ACAAACCGCAGAGAAACAAA
  Reverse CCTCCCTCTGCCCTAGTATG
ENSMUST00000092822 Forward GCAGACCCAGTCGTTGTAC
  Reverse AAGCCTGTGGCACAACATC
ENSMUST00000021620 Forward GGCTGAAGACAGTTGTGGAA
  Reverse GGGTAAATCTTGCCCTTTCA
ENSMUST00000073388 Forward GAGTCACTTGTCCGCAGCTGTC
  Reverse TCGCTGTCAGTTAAGTCCAGG
ENSMUST00000159720 Forward CGCTATTGTCTTCTTGATGGAC
  Reverse CTTCAACAGTTTCCCTGAGTTG
ENSMUST00000131456 Forward TGATGAGTAGCGTAAAGTACCC
  Reverse ATATGAGGCATCGTCAGGTAAG
ENSMUST00000185596 Forward ATCTCTTTGCCTTCCTCAATCA
  Reverse GTTTTGATCAGCTCATTCACGT
β-actin Forward GGTCAGAAGGACTCCTATGTGG
  Reverse TGTCGTCCCAGTTGGTAACA