Skip to main content

Table 1 Primer sequences for RT-qPCR

From: MicroRNA-205-5p plays a suppressive role in the high-fat diet-induced atrial fibrosis through regulation of the EHMT2/IGFBP3 axis

Gene Sequence (5′-3′)
miR-205-5p-F TCCTTCATTCCACCGGAGTCTG
miR-205-5p-R GCGAGCACAGAATTAATACGAC
EHMT2-F GCCAGGCCGGGAGGCCCTGGAA
EHMT2-R CTCCAGCCTGCAGCAGCACATG
IGFBP3-F GGTGTCTGATCCCAAGTTCC
IGFBP3-R ACCATATTCTGTCTCCCGCT
TGF-β1-F AACTCCGGTGACATCAAAAGATAA
TGF-β1-R TGCTGAGGCTCAAGTTAAAAGT
U6-F CTCGCTTCGGCAGCACA
U6-R ACGCTTCACGAATTTGCGT
GAPDH-F CCCTTAAGAGGGATGCTGCC
GAPDH-R ACTGTGCCGTTGAATTTGCC
  1. F forward, R reverse, miR microRNA, GAPDH glyceraldehyde phosphate dehydrogenase