Skip to main content

Table 1 List of primers used for quantitative real-time PCR

From: Comparative anti-inflammatory and lipid-normalizing effects of metformin and omega-3 fatty acids through modulation of transcription factors in diabetic rats

Gene Primer name Sequence (5′−3′)
GAPDH GAPDH F AGTTCAACGGCACAGTCAAG
GAPDH R TACTCAGCACCAGCATCACC
PPARγ PPARγ F AAGACAACAGACAAATCACC
PPARγ R CAGGGATATTTTTGGCATACTC
SREBP1 SREBP F AAACCTGAAGTGGTAGAAAC
SREBP R TTATCCTCAAAGGCTGGG
NFKB NFKB F AAAAACGAGCCTAGAGATTG
NFKB R ACATCCTCTTCCTTGTCTTC
FAS FAS F AAAAGGAAAGTAGAGTGTGC
FAS R GACACATTCTGTTCACTACAG
ACSL ACSL F ACATTATGAACGATTGCTCC
ACSL R GCATTACACACTCTACAACG
MCAT MCAT F AAAACTCTAGGCTCAATCAAC
MCAT R GGATGTGTGTATTTATGCCC
TNFα TNFα F CTCACACTCAGATCATCTTC
TNFα R GAGAACCTGGGAGTAGATAAG
  1. GAPDH glyceraldehyde-3-phosphate dehydrogenase, PPARγ peroxisome proliferator-activated receptors γ, SREBP1 sterol regulatory element-binding protein 1, NFκβ nuclear factor kappa β, FAS fatty acid synthase, ACSL long chain acyl CoA synthetases, MCAT malonyl-CoA-acyl carrier protein transacylase, TNFα tumor necrosis factor α (Make: Sigma-Aldrich; F forward primer sequence, R reverse primer sequence)