Skip to content

Advertisement

  • Research Paper
  • Open Access

Genetic polymorphisms influence runners’ responses to the dietary ingestion of antioxidant supplementation based on pequi oil (Caryocar brasiliense Camb.): a before-after study

  • 1Email author,
  • 1,
  • 1,
  • 1,
  • 2,
  • 1 and
  • 1
Genes & NutritionStudying the relationship between genetics and nutrition in the improvement of human health20116:217

https://doi.org/10.1007/s12263-011-0217-y

  • Received: 15 November 2010
  • Accepted: 17 March 2011
  • Published:

ABSTRACT

Genes have been implicated in the levels of oxidative stress, lipids, CVD risk, immune reactivity, and performance. Pequi oil (Caryocar brasiliense) has shown anti-inflammatory and hypotensive effects, besides reducing exercise-induced DNA, tissue damages, and anisocytosis. Given that diet can interact with the human genome to influence health and disease, and because genetic variability can influence response to diet, we aim to investigate the influence of 12 gene polymorphisms on inflammatory markers, postprandial lipids, arterial pressure, and plasma lipid peroxidation of runners (N = 125), before and after 14 days of 400 mg pequi-oil supplementation, after races under closely comparable conditions. Arterial pressure was checked before races; blood samples were taken immediately after racing to perform leukogram and plateletgram, Tbars assay, lipid, and CRP dosages and genotyping. CAT, GST-M1/T1, CRP-G1059C, and MTHFR-C677T polymorphisms influenced post-pequi-oil responses in leukogram; Hp and MTHFR-C677T, in plateletgram; Hp, ACE, GSTT1, and MTHFR-A1298C, in lipid profile; MTHFR-A1298C, in C-reactive protein (CRP) levels; and Hp and MnSOD, in Tbars assay. Differences between ACE genotypes in leukogram and total cholesterol disappeared after pequi, and the same occurred for Hp and MnSOD in Tbars assay and for MTHFR-A1298C with CRP levels. Because genetic inheritance is one of the factors that drive atherosclerosis-related lipid abnormalities, results can contribute to a greater understanding of the influence of genetic polymorphisms in situations that push up free radicals. Knowledge is also expanded on how antioxidant supplementation affects an individual’s genes and how athletic genetic makeup can affect the way a person responds to antioxidant supplements.

Keywords

  • Caryocar brasiliense Camb.
  • Genetic polymorphisms
  • Postprandial serum lipids
  • Inflammatory markers
  • TBARS assay

Introduction

Many athletes and individuals participating in regular exercise programs consume antioxidant supplements to avoid enhanced production of reactive oxygen and nitrogen species (RONS) in response to exercise, which may lead to modifications in lipids, proteins, nucleic acid, and other cellular compounds due to oxidative stress [37, 44, 109, 128, 144]. Some production of RONS is necessary for normal contractile activity of skeletal muscles [72, 144], and physical training is a known to induce antioxidant enzymes [44, 61]. However, strenuous exercise, mainly if above habitual intensity of effort, or training with very elevated frequency, generally overloads the endogenous antioxidant system’s capacity, leading to an increase in plasma lipid peroxidation [44] plus oxidative damage to muscles and other tissues [44, 61, 128, 132]. These damaging effects, with their consequent inflammatory processes, can jeopardize performance and may lead to overtraining syndrome, besides potentially contributing to an increased future risk of cardiovascular disease (CVD) [37, 44, 109, 131, 136]. These observations have led to research into whether antioxidant supplementation could prevent the damaging effects of RONS and thereby enhance performance [144]. It should be taken into account that: (1) the human physical performance phenomenon has always been of interest to specialists in sports medicine and exercise physiologists [42]; (2) certain characteristics related to performance are to some extent genetically determined [13, 19, 42, 76, 124]; and (3) exhausting exercise can also contribute to an increased future risk of CVD in athletes [118, 131]. Given this, knowledge on how individual genetic differences can affect response to antioxidant supplementation and how diet interacts with the human genome to influence performance, health, and disease is of unquestionable importance to the athlete’s performance and health.

Many potentially significant genetic variants related to oxidative stress have already been identified [45, 55]. These include single-nucleotide polymorphisms (SNPs): Val9Ala in the mitochondrial targeting sequence of the manganese (MnSOD) gene (NCBI, refSNP ID: rs1799725), −21A/T in the promoter region of the catalase (CAT) gene (NCBI, refSNP ID: rs7943316), and Pro198Leu of the glutathione peroxidase 1 (GPx-1) gene (NCBI, refSNP ID: rs1050450) [45]. The effect of these variations has not yet been clarified; however, most of the polymorphisms result in changes in the levels or the activities of these enzymes, which can lead to a reduction in protection against oxidative stress [12]. Genes have also been implicated in changed lipid levels [18, 22], increased CVD risk [15, 23, 34, 62, 85, 95], immune reactivity [69], biotransformation of many substances, including products of oxidative stress [36, 68, 147], and athletic performance [20, 42, 78].

In previous studies by our group, we demonstrated that the carotenoid-rich oil extracted from pequi pulp (Caryocar brasiliense Camb.), a typical fruit found in the Brazilian Cerrado, had anti-inflammatory properties, besides reducing arterial pressure, exercise-induced DNA, tissue damages, and anisocytosis [88, 89, 92]. Although the protective effects of pequi oil are unquestionable, some of these responses were influenced by genetic polymorphisms related to oxidative stress.

Diet can interact with the human genome to influence health and disease, and genetic variability can also influence the response to diet [63, 126]. We therefore aim in the present study to investigate the influence of genetic polymorphisms of haptoglobin (Hp), MnSOD (Val9Ala), CAT (−21A/T), GPx-1 (Pro198Leu), angiotensin I-converting enzyme (ACE), glutathione S-transferases M1 (GSTM1) and T1 (GSTT1), creatine kinase muscle type (CK-MM TaqI and NcoI), C-reactive protein (CRP G1059C), and methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) on the runners’ responses to the dietary ingestion of antioxidant supplementation based on pequi oil (Caryocar brasiliense Camb.). Their effects were evaluated after races in the same environment and under the same type, intensity and length of weekly training conditions.

Materials and methods

Study design and participants

The trial was conducted after preclinical and toxicological tests in mice [87]. Volunteers of both genders (76 men and 49 women) and different age groups (15–67) were recruited in high schools, colleges, universities, clubs, and companies in Brasília (Federal District/Brazil). The selection criterion (inclusion/exclusion criteria) used for the runners was that they had at least a 4,000-m run performance, keeping the race of the same type, intensity and length of weekly training, to guarantee no additional physical stress beyond what they are accustomed to, in order to avoid differences in training amount or intensity and consequent increased oxidative stress. They should participate in two races of the same route and time, before (control group) and after (treatment group) ingestion of 400 mg of pequi oil in capsules supplied daily for 14 consecutive days. The choice of this daily ingestion took into account the data from pequi literature and the maximum daily dose of provitamin A carotenoids (25 mg) recommended by the National Agency for Sanitary Surveillance (ANVISA). To avoid plasma volume changes as function of individual variability, each athlete participated as control group and treatment group, being compared in the statistical tests with him(her)self. There was no significant change in the daily routine, training, or lifestyle of all runners between the first race and the second race, except for ingestion of pequi-oil capsules.

The races before and after ingestion of pequi oil were run outdoors on flat tracks, under the same environmental conditions, and the athletes could choose the distance that they would cover (4–21 km), according to their type, intensity and length of weekly training; both races for each athlete were the same distance. The time needed by each athlete to finish the races was similar in the two races, guaranteeing the same intensity (time needed to finish the race) of races before and after pequi-oil supplementation. The volunteers were informed about the purpose of the study; all of them received a random number generated by computer and were free to withdraw at any time during the study. After the first race, they received the capsules and were instructed to take them for 14 days during or immediately after lunch until the second race.

This study was conducted according to the guidelines laid down in the Declaration of Helsinki, and all procedures involving human subjects were approved by the Ethics Committee for Health Sciences Faculty Research of the University of Brasília and by the National Commission for Ethics in Research (CONEP), number 0.001668/2005–2018. Written informed consent was obtained from all subjects.

Preparation of capsules

Pequi fruit was obtained in natura from the local markets of Brasília/DF (Brazil) and surrounding areas. The internal mesocarp was peeled to obtain the pulp, which was packed in a covered pot and frozen at −86°C until the moment of its use. Pequi oil was extracted by cold maceration using chloroform as a solvent. The extract was submitted to evaporation under reduced pressure for solvent removal and dried at high vacuum. Pequi oil, whose relative composition is shown in Table 1, was then incorporated in Aerosil (colloidal silicon dioxide) q.s.p., so that the users ingested a daily dose of 400 mg of pequi oil. The capsule production was patented as number PI0601631-6 (National Institute of Industrial Property—INPI).
Table 1

Relative composition of pequi (Caryocar brasiliense Camb.) pulp-oil capsules

Saturated

Fatty acidsa

Carotenoidsb

Quantity (mg/100 g)

Carbon number

Quantity (%)

Mono-unsaturated

Carbon number

Quantity (%)

Types

Palmitic

C16:0

41.78

Oleic

C18:1 (ω9)

54.28

Provitamin A

6.26–11.5

Stearic

C18:0

1.28

Palmitoleic

C16:1 (ω7)

0.67

Lycopene

1.12–2.08

Araquidic

C20:0

0.12

Bi-unsaturated

    
   

Linoleic

C18:2 (ω6)

1.36

  
   

Tri-unsaturated

    
   

Linolenic

C18:3 (ω3)

0.51

  
 

Total

43.18

 

Total

56.82

Total

6.75–28.66

The Omega nomenclature, which is defined according to carbon numeration associated with the first double bonds (3rd, 6th, 7th, or 9th) from the methyl group, is correlated to unsaturated fatty acids

aPresent study and Miranda-Vilela et al. [90]

bRamos et al. [110], Azevedo-Meleiro and Rodriguez-Amaya [9], Oliveira et al. [101] and Lima et al. [75]

Procedures and measurements

Waist circumference (WC), hip circumference, waist-hip ratio, and body mass index (BMI) were checked before the first race as previously described [88]. All volunteers had their arterial pressure checked before each race. Blood samples were drawn with EDTA immediately after races in two rounds: (1) race without pequi-oil supplementation and (2) race after ingestion of 400 mg of pequi oil in capsules supplied daily for 14 consecutive days. Blood samples were used to count white blood cells and platelets, and for genotyping of the polymorphisms, while serum samples were submitted to TBARS assay and dosages of postprandial lipid profile and C-reactive protein (CRP and high-sensitivity CRP—hs-CRP).

Biochemical analyses and cell counts

Serum postprandial lipid profile and CRP analyses were run on the automated chemistry analyzer ADVIA 1650 (Bayer Diagnostics), using the appropriate Advia chemistry reagents. Leukocyte and platelet counts were carried out in the automated analyzer Cell-Dyn 3700 (Abbott Diagnostics), and hs-CRP was measured by an immunometric assay (Immulite 2000, DPC, Medlab). The TBARS assay was carried out according to Wasowicz et al. [141].

Genotyping of the polymorphisms

Peripheral blood samples were collected in Vacutainer tubes containing EDTA, and genomic DNA was isolated from the buffy-coat layer using the GFX purification kit (GE Healthcare, Buckinghamshire, England). DNA samples were stored at −20°C until analysis.

Hp genotypes were determined by allele-specific PCR (Polymerase Chain Reaction) as described by Yano et al. [143]. Identification of alleles Hp *1F , Hp *1S , and Hp *2 was based on product analysis of three independent PCR. MnSOD, CAT, GPx-1, CK-MM, CRP, and MTHFR genotypes were determined by polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP) assays performed as described by Mitrunen et al. [94] (MnSOD), Ukkola et al. [134] (CAT), Zhao et al. [147] (GPx-1), Rivera et al. [113], Zhou et al. [148, 149] (CK), Suk et al. [127] (CRP), and Yi et al. [145] (MTHFR). DNA fragments containing I/D polymorphism in intron 16 of the ACE gene were amplified by PCR as previously described by Rigat et al. [112], using DMSO (dimethyl sulfoxide) as recommended by Odawara et al. [100], to avoid mistyping of the DD genotype. The glutathione S-transferase (GST) GSTM1 and GSTT1 fragments were amplified simultaneously as proposed by Chen et al. [29], using β-globin as positive control. The absence of an amplification product combined with the presence of a positive control band (268-bp DNA fragment of β-globin) indicated the null (variant) type for both polymorphisms (Table 2). PCR and PCR-based RFLP products were separated by electrophoresis in 10 (GPX1) and 6% (other polymorphisms) non-denaturing polyacrylamide gels and visualized by staining with silver nitrate.
Table 2

Chromosome location, primer sequences, and restriction enzymes used in the genotyping of Haptoglobin (Hp), MnSOD, CAT, GPx-1, ACE, GSTM1, GSTT1, CK-MM, CRP, and MTHFR genes’ polymorphisms

Genetic Markers

Chromosome location

Primer sequences

Restriction enzymes

References

Hp *1F

16q22.1

 

[143]

F3

 

5′ CAGGAGTATACACCTTAAATG 3′

  

C72

 

5′ AATTTAAAATTGGCATTTCGCC 3′

  

Hp *1S

    

C51

 

5′ GCAATGATGTCACGGATATC 3′

  

S2

 

5′ TTATCCACTGCTTCTCATTG 3′

  

Hp *2

    

F3

 

5′ CAGGAGTATACACCTTAAATG 3′

  

C42

 

5′ TTACACTGGTAGCGAACCGA 3′

  

MnSOD

6q25.3

 

Ngo MIV

[94]

Sense

 

5′ ACCAGCAGGCAGCTGGCGCCGG 3′

  

Antisense

 

5′ GCGTTGATGTGAGGTTCCAG 3′

  

CAT

11p13

 

Hinf I

[134]

Sense

 

5′ AATCAGAAGGCAGTCCTCCC 3′

  

Antisense

 

5′ TCGGGGAGCACAGAGTGTAC 3′

  

GPx-1

3p21.3

 

Apa I

[147]

Sense

 

5′AGCCCAACTTCATGCTCTTC 3′

  

Antisense

 

5′CAGGTGTTCCTCCCTCGTAG 3′

  

ACE

17q23

 

[100, 112]

Sense

 

5′ CTGCAGACCACTCCCATCCTTTCT 3′

  

Antisense

 

5′ GATGTGGCCATCACATTCGTCAGAT 3′

  

GSTM1

1p13.3

 

[29]

GSTM1/6

 

5′ GCTTACCGTGTTATGGAGGTTC 3′

  

GSTM1E7A

 

5′ TTGGGAAGGCGTCCAAGCGC3′

  

GSTM1E7

 

5′ TTGGGAAGGCTGCCAAGCAG 3′

  

GSTT1

22q11.2

 

 

Sense

 

5′ TTGGGAAGGCGTCCAAGCGC3′

  

Antisense

 

5′ TTGGGAAGGCGTCCAAGCGC3′

  

β-globin

11p15.5

Positive control

 

Beta 1

 

5′ CAACTTCATCCACGTTCACC3′

  

Beta 2

 

5′ GAAGAGCCAAGGACAGTTAC3′

  

CK-MM

19q13.2–q13.3

 

NcoI e TaqI

[113, 148, 149]

Sense

 

5′ GTGCGGTGGACACAGCTGCCG 3′

  

Antisense

 

5′ CAGCTTGGTCAAAGACATTGAGG 3′

  

CRP G1059C

1q21–q23

 

MaeIII

[127]

Sense

 

5′GCCCAGGGTGAGGAAGAGTCT 3′

  

Antisense

 

5′ CCCGCCAGTTCAGGACATTAG 3′

  

MTHFR C677T

1p36.3

  

[145]

Sense

 

5′ TGAAGGAGAAGGTGTCTGCGGGA 3′

HinfI

 

Antisense

 

5′ AGGACGGTGCGGTGAGAGTG 3′

  

MTHFR A1298C

    

Sense

 

5′ CAAGGAGGAGCTGCTGAAGA 3′

MboII

 

Antisense

 

5′ CCACTCCAGCATCACTCACT 3′

  

Statistical analyses

Allelic and genotypic frequencies were estimated by gene counting, and the goodness of fit of the genotype distribution to Hardy–Weinberg equilibrium (HWE) was assessed by the chi-square (χ2) test. Values of P > 0.05 indicated HWE. Data for genetic diversity were assessed by comparing the observed and expected heterozygosities; F IS (inbreeding coefficient), probability (P) values, and linkage disequilibrium test for the two polymorphisms of CK and MTHFR were generated using Genepopweb Statistical Program version 4.0 (http://genepop.curtin.edu.au). Although for the used biochemical markers and cell counts there are no differences between sexes for clinical purposes, the distribution frequencies of the genotypes of each polymorphism between sexes were also tested through the Mann–Whitney U test.

Statistical analysis was carried out using SPSS (Statistical Package for the Social Sciences) version 15.0. Data were expressed as mean ± SEM (standard error of mean) and values of P < 0.05 were considered statistically significant. Because the possible correlations between sex/age groups, sex/distance covered, and age groups/distance covered have been previously reported [88], the correlations analyzed here through chi-square correlation test were limited to the following parameters: genetic markers/sex, genetic markers/age groups, and genetic markers/distance covered. The continuous variables were tested for normal distribution with Shapiro–Wilk. For the analyzed parameters, statistical analyses on the influences of pequi-oil intake on the total and sex groups, as well as on the age groups and distance covered, have also been previously described [88]. Therefore, this study evaluated only the influences of the genetic polymorphisms on plasma lipid peroxidation, postprandial serum lipids, inflammatory response, and arterial pressure of runners before and after pequi-oil supplementation. For GSTM1, GSTT1, and CRP G1059C, the influence of the polymorphisms was investigated through the independent samples t-test or the Mann–Whitney U test (when the data were not normally distributed); for the other genetic markers, these influences were verified by ANOVA or by the Kruskall–Wallis test (when the data were not normally distributed). For significant ANOVA results, Bonferroni’s post hoc test was chosen to carry out 2-to-2 comparisons; for significant Kruskal–Wallis results, Mann–Whitney U test was performed. To verify differences in the comparison of before-after pequi-oil supplementation, the statistical significance was assessed by the paired-samples t-test or the Wilcoxon matched pairs test (when the data were not normally distributed).

Results

Allele and genotype frequencies and Hardy–Weinberg equilibrium

There were significant deviations from Hardy–Weinberg equilibrium (HWE) for the Hp, MnSOD, GSTM1, and GSTT1 loci. For the Hp locus, it was appropriate to a heterozygote deficit (P = 0.0012), while for the MnSOD locus, to a heterozygote excess (P = 0.0000). For GSTM1 and GSTT1, results were compatible with heterozygote deficit, due to homozygous (+/+, wild type) and heterozygous (±) being considered together within non-null genotypes, given that the PCR method is not suitable for distinguishing these genotypes. According to data of heterozygosity-observed (H o) and heterozygosity-expected (H e) of the Hp locus, the main factors that contributed to deviation from HWE were the higher frequencies of Hp1F-1F and Hp1S-1S with regard to the expected as well as the lower observed frequency of Hp1F-1S. When the Hp *1 alleles were treated as a single block, the genotypic distributions were in accordance with the EHW (P = 0.2133). The MnSOD locus presented a heterozygosity-observed (H o) value higher than the heterozygosity-expected (H e) value, and an F IS (inbreeding coefficient) value compatible with selection in favor of heterozygotes. The genotypic distributions of CAT, GPx-1, ACE, CK NcoI, CK TaqI, CRP G1059C, MTHFR C677T, and MTHFR A1298C loci were in accordance with HWE (Table 3). A strong linkage disequilibrium was detected only between the CK NcoI and the TaqI RFLPs (P = 0.00047), with 11 individuals carrying AA/1-1 haplotype, 32 carrying AA/1-2 haplotype, 19 carrying AA/2-2 haplotype, 1 carrying AG/1-1 haplotype, 28 carrying AG/1-2 haplotype, 27 carrying AG/2-2 haplotype, and 7 carrying GG/2-2 haplotype; nobody presented GG/1-1 or GG/1-2 haplotypes (data not provided in Tables). Between the sexes, there was a significant difference in the distribution frequencies of the genotypes only for the CAT polymorphism (P = 0.030; Fig. 1).
Table 3

Distribution of Haptoglobin (Hp), MnSOD, CAT, GPx-1, ACE, GSTM1, GSTT1, CK NcoI, CK TaqI, CRP G1059C, MTHFR C677T and MTHFR A1298C allele frequencies, genetic diversity parameters, genotype frequencies, and Hardy–Weinberg equilibrium data for chi-square (χ2) test

Genetic Markers

Allele frequencies

Heterozygosity-observed (H o)

Heterozygosity-expected (H e)

FIS (Inbreeding coefficient)

Genotypes

Genotype frequencies

Number of observed individuals

Number of expected individuals

HWE test (P values)

Hp*

Hp *1F

0.176

0.504

0.617

+0.1831

1F-1F

0.064

8

3.87

0.0117

      

1F-1S

0.064

8

14.61

 
 

Hp *1S

0.332

   

1S-1S

0.160

20

13.78

 
      

1F-2

0.160

20

21.65

 
 

Hp *2

0.492

   

1S-2

0.280

35

40.84

 
      

2-2

0.272

34

30.25

 

MnSOD*

Val

0.568

0.800

0.491

−0.6293

Val/Val

0.168

21

40.33

0.0000

 

Ala

0.432

   

Val/Ala

0.800

100

61.34

 
      

Ala/Ala

0.032

4

23.33

 

CAT

A

0.396

0.424

0.478

+0.1130

AA

0.184

23

19.60

0.3173

 

T

0.604

   

AT

0.424

53

59.80

 
      

TT

0.392

49

45.60

 

GPx-1

Pro

0.688

0.400

0.429

+0.0676

Pro/Pro

0.488

61

59.17

0.4458

 

Leu

0.312

   

Pro/Leu

0.400

50

53.66

 
      

Leu/Leu

0.112

14

12.17

 

ACE

D

0.604

0.488

0.478

−0.0209

DD

0.360

45

45.60

0.8225

 

I

0.396

   

ID

0.488

61

59.80

 
      

II

0.152

19

19.60

 

GSTM1*

Null

0.648

Null

0.648

81

52.49

0.0000

 

Present

0.352

   

Non-null

0.352

44

72.51

 

GSTT1*

Null

0.136

Null

0.136

17

2.31

0.0000

 

Present

0.864

   

Non-null

0.864

108

122.69

 

CK NcoI

A

0.720

0.448

0.403

−0.1117

AA

0.496

62

64.80

0.2141

 

G

0.280

   

AG

0.448

56

50.40

 
      

GG

0.056

7

9.80

 

CK TaqI

1

0.336

0.480

0.446

−0.0762

1-1

0.096

12

14.11

0.5479

 

2

0.664

   

1-2

0.480

60

55.78

 
      

2-2

0.424

53

55.11

 

CRP G1059C

G

0.948

0.104

0.099

−0.0508

GG

0.896

112

112.34

0.5394

 

C

0.052

   

GC

0.104

13

12.32

 

MTHFR C677T

C

0.672

0.400

0.441

+0.0930

CC

0.472

59

56.45

0.3008

 

T

0.328

   

CT

0.400

50

55.10

 
      

TT

0.128

16

13.45

 

MTHFR A1298C

A

0.796

0.376

0.325

−0.1569

AA

0.608

76

79.20

0.0779

 

C

0.204

   

AC

0.376

47

40.60

 
      

CC

0.016

2

5.20

 

P < 0.05 indicates deviation from Hardy–Weinberg equilibrium, appropriate to a heterozygote deficit for Hp locus (p = 0.0012) and a heterozygote excess for MnSOD locus (P = 0.0000). P values were generated using statistical program Genepopweb version 4.0 (http://genepop.curtin.edu.au). For GSTM1 and GSTT1, genotypes were considerate as follows: Null = −/−; Non-null = +/+ and ±

Fig. 1
Fig. 1

Distribution frequencies of the genotypes of Haptoglobin (Hp), MnSOD, CAT, GPx-1, ACE, GSTM1, GSTT1, CK NcoI, CK TaqI, CRP G1059C, MTHFR C677T, and MTHFR A1298C polymorphisms between sexes. P values were generated by the Mann–Whitney U test. Asterisks indicate significant differences between the distribution frequencies of the genotypes between sexes (P = 0.030)

Correlation test

There was a significant correlation between sex and CAT (P = 0.027), and distance covered and CKTaqI (P = 0.035; Fig. 2).
Fig. 2
Fig. 2

Significant correlations between a sex and CAT-21A/T genotypes; b distance covered and CK-MM TaqI genotypes. P values were generated by the chi-square correlation test: a P = 0.027; b P = 0.035

Leukogram

For total leukocytes, significant differences in the comparison of before-after pequi-oil supplementation were showed for CRP CG (P = 0.043) genotype, whose values increased after pequi. For lymphocytes, GPx-1 Pro/Pro (P = 0.033) and CK NcoI AA (P = 0.035) genotypes presented decreased values after supplementation, while the number of segmented increased for CRP GC (P = 0.011) genotype. CAT AT (P = 0.008), GPx-1 Pro-Leu (P = 0.036), CK NcoI AG (0.010), MTHFR677 CC (0.018), and MTHFR1298 AA (P = 0.013) genotypes showed significant increase in the values of basophils after pequi-oil treatment, while eosinophils were enhanced for Hp 1S-2 (P = 0.024), CAT AA (P = 0.017), GPx-1 Leu/Leu (P = 0.046), GSTM1 null (P = 0.027), and MTHFR677 TT (P = 0.036) genotypes, but all of them were inside the reference values. Pequi oil also resulted in increased monocytes for MnSOD Val/Ala (P = 0.027), CAT AT (P = 0.033), GPx-1 Pro/Leu (P = 0.001), GSTM1 null (P = 0.006), GSTT1 non-null (P = 0.002), CK NcoI AG (P = 0.017), CK TaqI 2-2 (P = 0.006), CRP CG (P = 0.028), and MTHFR677 CC (P = 0.040) genotypes; for GSTT1 null (P = 0.023), values dropped after supplementation (Table 4).
Table 4

Influences of Haptoglobin (Hp), MnSOD, CAT, GPx-1, ACE, GSTM1, GSTT1, CK NcoI, CK TaqI, CRP G1059C, MTHFR C677T and MTHFR A1298C genes’ polymorphisms on the leukogram before and after pequi-oil supplementation

Genetic Markers

Total leukocytes (/mm3)

Lymphocytes (/mm3)

Segmented (/mm3)

Rods (/mm3)

Basophils (/mm3)

Eosinophils (/mm3)

Monocytes (/mm3)

Before

After

Before

After

Before

After

Before

After

Before

After

Before

After

Before

After

Hp

 1F-1F

6,425.00 ± 290.78

6,850.00 ± 548.05

2,313.75 ± 197.11

2,359.00 ± 299.70

3,435.25 ± 268.34

3,704.00 ± 488.19

13.25 ± 13.25

11.38 ± 11.38

79.13 ± 16.48

91.88 ± 11.19

149.00 ± 22.29

112.13 ± 19.04

434.63 ± 68.44

571.63 ± 66.68

 1F-1S

7,487.50 ± 1,291.93

7,000.00 ± 853.77

1,923.75 ± 193.56

2,297.63 ± 276.28

4,740.13 ± 1,176.15

3,909.50 ± 607.49

101.00 ± 64.76

26.50 ± 26.50

83.00 ± 14.49

79.50 ± 13.40

101.25 ± 23.42

134.38 ± 47.93

539.50 ± 93.29

549.88 ± 94.59

 1S-1S

7,994.12 ± 715.15

7,764.71 ± 605.61

2,719.56 ± 209.79

2,586.89 ± 184.12

4,470.89 ± 596.70

4,343.22 ± 465.01

28.22 ± 19.38

26.35 ± 16.53

74.17 ± 12.39

89.22 ± 12.95

175.56 ± 32.29

173.44 ± 36.23

524.50 ± 52.14

556.72 ± 49.65

 1F-2

7,515.00 ± 414.49

7,690.00 ± 329.03

2,840.05 ± 199.83

2,651.90 ± 169.33

3,914.45 ± 265.02

4,024.95 ± 301.57

3.32 ± 3.32

5.11 ± 5.11

88.45 ± 12.73

105.30 ± 10.36

158.55 ± 31.11

152.05 ± 29.82

491.60 ± 40.33

586.10 ± 47.22

 1S-2

7,103.12 ± 419.06

7,090.63 ± 356.60

2,599.75 ± 206.66

2,656.38 ± 237.66

3,788.91 ± 267.41

3,644.50 ± 218.58

37.81 ± 18.06

43.25 ± 20.76

77.03 ± 8.51

93.22 ± 7.83

129.69 ± 18.90

155.41 ± 15.49*

462.44 ± 36.09

495.66 ± 31.21

 2-2

7,696.87 ± 311.91

7,771.88 ± 316.01

2,885.69 ± 164.48

2,743.87 ± 169.69

4,021.81 ± 229.42

4,156.53 ± 234.81

11.72 ± 6.90

26.28 ± 15.44

100.56 ± 9.21

111.13 ± 8.73

149.75 ± 20.97

165.34 ± 26.74

524.69 ± 46.44

569.59 ± 39.20

 P values

0.433

0.437

0.070

0.810

0.728

0.517

0.314

0.857

0.373

0.276

0.625

0.684

0.816

0.607

MnSOD

 Val/Val

7,305.26 ± 508.09

7,136.84 ± 423.87

2,871.68 ± 304.69

2,597.79 ± 210.58

3,711.79 ± 270.98

3,670.47 ± 326.61

8.72 ± 6.03

15.78 ± 15.78

75.16 ± 9.94

87.16 ± 8.91

176.84 ± 33.90

183.74 ± 25.56

457.11 ± 50.54

500.42 ± 49.65

 Val/Ala

7,484.95 ± 237.47

7,523.66 ± 206.72

2,644.79 ± 93.08

2,628.18 ± 107.11

4,076.53 ± 188.75

4,042.41 ± 151.86

30.39 ± 9.44

29.99 ± 9.24

87.04 ± 5.51

101.46 ± 5.06

141.76 ± 11.36

149.90 ± 13.50

503.16 ± 23.01

557.33 ± 21.27*

 Ala/Ala

7,240.00 ± 1,027.91

7,380.00 ± 673.35

2,403.00 ± 242.8

2,651.20 ± 286.97

4,078.60 ± 839.11

3,898.40 ± 458.03

11.20 ± 11.20

0.00 ± 0.00

94.80 ± 10.50

85.80 ± 10.32

118.00 ± 42.3

163.40 ± 37.81

534.40 ± 102.24

581.20 ± 79.12

 P values

0.908

0.823

0.793

0.924

0.865

0.675

0.803

0.442

0.298

0.346

0.764

0.178

0.567

0.413

CAT

 AA

7,280.00 ± 558.83

6,920.00 ± 425.85

2,739.43 ± 230.87

2,728.10 ± 209.69

3,856.81 ± 472.24

3,473.38 ± 261.02

13.43 ± 13.43

24.81 ± 20.49

77.90 ± 11.97

75.19 ± 7.82

139.24 ± 18.77

180.71 ± 29.16**,

482.86 ± 45.05

551.43 ± 44.30

 AT

7,540.00 ± 309.01

7,728.00 ± 283.23

2,799.60 ± 141.04

2,746.08 ± 157.72

3,975.84 ± 224.25

4,037.00 ± 220.21

26.34 ± 11.78

27.62 ± 12.62

84.94 ± 7.33

113.96 ± 6.87**,a,≠,*,c

151.48 ± 18.82

145.54 ± 18.38

490.68 ± 28.67

563.22 ± 27.78*,

 TT

7,414.89 ± 332.48

7,391.49 ± 274.95

2,503.81 ± 129.93

2,448.28 ± 127.73

4,134.60 ± 249.53

4,136.74 ± 204.45

31.98 ± 13.55

26.02 ± 11.17

89.38 ± 7.14

92.45 ± 6.49

144.19 ± 16.11

155.89 ± 17.48

510.21 ± 36.45

533.23 ± 32.21

 P values

0.757

0.412

0.407

0.525

0.393

0.151

0.311

0.917

0.758

0.004

0.954

0.556

0.942

0.805

GPx-1

 Pro/Pro

7,787.93 ± 324.14

7,484.48 ± 272.35

2,689.93 ± 131.51

2,516.60 ± 128.63*,

4,312.79 ± 266.69

4,168.45 ± 196.70

39.59 ± 13.99

32.38 ± 11.54

90.53 ± 6.19

102.28 ± 7.12

138.02 ± 15.27

129.81 ± 13.62

512.07 ± 31.61

529.48 ± 24.85

 Pro/Leu

7,030.43 ± 286.62

7,373.91 ± 263.72

2,619.77 ± 143.84

2,692.94 ± 143.41

3,706.91 ± 188.07

3,806.43 ± 195.90

7.09 ± 3.17

25.98 ± 13.24

77.57 ± 7.95

94.28 ± 5.89*

160.64 ± 18.16

184.49 ± 22.07

480.04 ± 29.17

582.83 ± 32.73*,

 Leu/Leu

7,384.62 ± 622.63

7,607.69 ± 558.67

2,772.46 ± 221.73

2,856.31 ± 323.78

3,826.46 ± 446.38

3,734.31 ± 433.76

36.75 ± 28.07

0.00 ± 0.00

91.31 ± 15.08

96.85 ± 9.09

132.31 ± 22.70

169.15 ± 27.42

491.69 ± 61.19*,≠

515.38 ± 58.35

 P values

0.427

0.981

0.678

0.454

0.588

0.712

0.307

0.196

0.294

0.918

0.639

0.109

0.791

0.355

ACE

 DD

7,036.59 ± 356.98

7,319.51 ± 328.45

2,686.63 ± 157.06

2,667.78 ± 170.95

3,607.46 ± 240.84

3,794.80 ± 228.24

29.61 ± 13.42

35.52 ± 15.41

77.85 ± 7.34

92.05 ± 8.44

131.80 ± 14.50

131.90 ± 11.56

503.29 ± 36.44

562.56 ± 33.02

 ID

8,013.79 ± 301.45*,a,c

7,632.76 ± 266.94

2,761.20 ± 120.09

2,657.81 ± 123.92

4,461.86 ± 253.69*,a

4,136.25 ± 186.21

28.93 ± 12.17

19.05 ± 10.08

91.68 ± 6.93

103.07 ± 5.48

157.92 ± 17.25

179.22 ± 20.77

505.51 ± 29.13

560.44 ± 28.43

 II

6,544.44 ± 374.97

7,188.89 ± 269.21

2,340.22 ± 239.79

2,415.17 ± 226.57

3,497.50 ± 213.75

3,866.22 ± 349.23

9.89 ± 5.74

30.39 ± 18.08

82.39 ± 12.27

98.17 ± 10.63

141.89 ± 25.58

134.28 ± 18.46

455.22 ± 45.57

481.78 ± 32.80

 P values

0.009

0.482

0.188

0.625

0.028

0.360

0.774

0.512

0.287

0.352

0.891

0.576

0.577

0.345

GSTM1

 Null

7,306.49 ± 235.12

7,254.55 ± 208.22

2,735.84 ± 107.97

2,661.48 ± 115.81

3,853.82 ± 180.95

3,758.60 ± 142.72

18.24 ± 8.04

14.75 ± 8.35

82.04 ± 5.54

93.56 ± 5.00

135.21 ± 12.70

153.01 ± 13.27*,

481.71 ± 24.97

553.49 ± 24.08**,

 Non-null

7,712.50 ± 412.00

7,840.00 ± 335.69

2,549.44 ± 157.54

2,554.37 ± 152.86

4,326.02 ± 307.62

4,385.51 ± 264.55

41.07 ± 15.98

48.80 ± 15.72**,a

91.88 ± 8.62

107.76 ± 8.03

167.41 ± 19.26

161.39 ± 22.51

525.90 ± 35.38

541.07 ± 31.07

 P values

0.627

0.276

0.268

0.543

0.232

0.092

0.077

0.003

0.367

0.153

0.102

0.966

0.247

0.828

GSTT1

 Null

8,482.35 ± 680.41

8,176.47 ± 552.77

2,970.29 ± 236.03

2,957.88 ± 195.32

4,511.65 ± 601.57

4,132.41 ± 460.59

6.24 ± 6.24

27.59 ± 21.49

100.12 ± 12.43

97.65 ± 7.70

218.76 ± 37.75

201.12 ± 33.01

651.76 ± 44.99

577.47 ± 48.18*,

 Non-null

7,269.00 ± 212.09

7,332.00 ± 186.69

2,620.71 ± 95.92

2,568.11 ± 101.73*,a

3,934.78 ± 157.17

3,950.17 ± 135.82

29.64 ± 8.89

26.30 ± 8.42

82.99 ± 5.05

98.63 ± 4.89

134.22 ± 10.38*,a

148.32 ± 12.29*,a

471.03 ± 21.63**,a

544.42 ± 20.71**,

 P Values

0.068

0.106

0.141

0.038

0.280

0.696

0.224

0.989

0.138

0.646

0.014

0.047

0.001

0.476

CK NcoI

 AA

7,337.29 ± 256.20

7,222.03 ± 233.48

2,663.32 ± 118.60

2,493.18 ± 115.56*,

3,904.80 ± 178.46

3,926.12 ± 189.84

32.19 ± 11.64

36.68 ± 13.30

89.42 ± 6.84

94.27 ± 6.13

151.63 ± 13.04

155.70 ± 14.87

504.23 ± 30.06

527.20 ± 25.19

 AG

7,634.62 ± 363.81

7,671.15 ± 293.73

2,727.71 ± 146.35

2,773.42 ± 154.12

4,164.98 ± 295.52

3,996.40 ± 202.09

20.25 ± 11.12

17.82 ± 8.71

80.98 ± 6.63

104.15 ± 6.57*

146.19 ± 18.94

161.17 ± 19.94

484.15 ± 28.76

554.10 ± 29.57*,≠

 GG

6,866.67 ± 644.29

7,866.67 ± 742.37

2,257.83 ± 262.59

2,642.33 ± 393.94

3,874.00 ± 462.32

4,306.33 ± 509.29

19.67 ± 12.70

0.00 ± 0.00

84.67 ± 25.48

91.67 ± 14.85

95.83 ± 17.64

112.67 ± 20.94

537.33 ± 106.28

726.33 ± 80.91

 P values

0.777

0.490

0.570

0.581

0.994

0.761

0.198

0.437

0.688

0.748

0.299

0.826

0.922

0.094

CK TaqI

 1-1

7,272.73 ± 564.74

7,081.82 ± 602.69

2,666.27 ± 256.58

2,288.09 ± 229.55

4,021.91 ± 525.48

4,095.00 ± 592.83

7.91 ± 7.91

17.09 ± 11.47

66.45 ± 16.36

97.36 ± 13.93

94.45 ± 18.88

92.09 ± 15.60

406.18 ± 60.78

492.18 ± 51.26

 1-2

7,284.21 ± 279.22

7,335.09 ± 223.92

2,658.65 ± 124.93

2,600.11 ± 120.46

3,849.95 ± 216.42

3,873.40 ± 178.49

23.18 ± 11.43

23.21 ± 11.14

87.58 ± 6.17

95.77 ± 5.66

140.67 ± 14.55

150.67 ± 15.99

513.60 ± 23.92

536.18 ± 25.51

 2-2

7,671.43 ± 359.75

7,677.55 ± 315.25

2,686.30 ± 146.77

2,725.76 ± 160.63

4,208.46 ± 262.99

4,067.78 ± 205.00

33.92 ± 12.55

32.35 ± 13.25

87.22 ± 7.79

101.84 ± 7.36

164.36 ± 18.26

175.96 ± 19.74

498.22 ± 37.33

576.54 ± 32.13**,

 P values

0.809

0.822

0.983

0.534

0.538

0.676

0.284

0.64

0.508

0.919

0.244

0.138

0.308

0.402

CRP G1059C

 GG

7,349.04 ± 225.92

7,257.69 ± 183.85

2,626.70 ± 95.98

2,556.44 ± 92.16

3,976.72 ± 174.77

3,874.71 ± 139.61

28.91 ± 8.59

27.36 ± 8.63

86.35 ± 5.00

97.85 ± 4.68

142.18 ± 10.72

151.23 ± 11.39

488.79 ± 21.44

526.35 ± 18.48

 GC

8,215.38 ± 488.70

9,030.77 ± 507.30**,a,*,≠

3,029.46 ± 217.56

3,172.08 ± 357.89

4,350.38 ± 335.73

4,797.92 ± 373.79*,a,≠

4.85 ± 4.85

19.62 ± 13.72

78.23 ± 13.83

103.69 ± 10.63

180.46 ± 44.49

193.85 ± 52.30

563.92 ± 65.40

733.54 ± 69.46**,a, *,

 P values

0.092

0.003

0.079

0.096

0.173

0.020

0.351

0.757

0.692

0.484

0.594

0.674

0.173

0.004

MTHFR C677T

 CC

7,201.79 ± 352.16

7,155.36 ± 249.82

2,592.72 ± 127.15

2,580.26 ± 130.98

3,941.67 ± 281.28

3,796.54 ± 183.41

27.58 ± 9.12

19.51 ± 8.28

78.79 ± 6.69

95.70 ± 5.67*,≠

120.11 ± 13.46

137.16 ± 17.79

445.26 ± 32.54

512.04 ± 26.05

 CT

7,597.83 ± 276.69

7,784.78 ± 303.59

2,645.91 ± 144.50

2,636.72 ± 148.85

4,101.87 ± 199.01

4,245.48 ± 227.81

31.52 ± 15.92

40.07 ± 16.77

92.13 ± 7.65

98.91 ± 7.96

176.26 ± 18.90*,a

171.61 ± 16.08*,a

545.30 ± 26.25

585.04 ± 31.33

 TT

7,886.67 ± 462.38

7,560.00 ± 464.64

3,046.00 ± 244.37

2,753.27 ± 277.07

4,050.00 ± 289.17

3,834.87 ± 339.58

3.43 ± 3.43

11.29 ± 11.29

90.33 ± 12.86

107.80 ± 10.17

154.73 ± 29.35

179.13 ± 36.43*,a,≠

546.00 ± 55.65

580.33 ± 54.72

 P values

0.129

0.347

0.235

0.932

0.172

0.386

0.339

0.791

0.401

0.481

0.038

0.029

0.018

0.394

MTHFR A1298C

 AA

7,512.86 ± 278.82

7,625.71 ± 241.07

2,713.39 ± 109.73

2,746.48 ± 118.22

4,039.68 ± 230.33

4,030.17 ± 180.08

29.75 ± 10.28

20.54 ± 8.21

76.96 ± 5.87

99.90 ± 6.08*

145.48 ± 13.49

164.86 ± 16.04

512.66 ± 28.33

566.37 ± 25.67

 AC

7,175.56 ± 263.14

7,093.33 ± 252.39

2,520.11 ± 134.50

2,348.73 ± 130.06*,a,c

3,919.56 ± 184.62

3,883.69 ± 200.39

18.11 ± 11.56

34.36 ± 15.80

96.33 ± 7.62

94.84 ± 5.97

148.02 ± 18.46

144.49 ± 16.90

460.69 ± 27.20

516.60 ± 27.83

 CC

11,150.00 ± 4,950.00

9,600.00 ± 2,700.00

4,565.50 ± 1,713.50

4,485.00 ± 1,173.00

5,457.00 ± 2,915.00

4,155.00 ± 1,257.00

80.50 ± 80.50

61.50 ± 61.50

142.50 ± 18.50

130.50 ± 7.50

142.50 ± 18.50

96.00 ± 27.00

762.00 ± 204.00

672.00 ± 189.00

 P values

0.715

0.255

0.167

0.024

0.944

0.880

0.241

0.279

0.038

0.363

0.898

0.542

0.149

0.456

Data are expressed as mean ± SEM (standard error of mean). For GSTM1, GSTT1, and CRP G1059C, P values were generated by the Mann–Whitney U test; for the other genetic markers, P values were generated by the Kruskall–Wallis test. The lower case letters indicate differences between two specific genotypes detected by the Mann–Whitney U test. Asterisks indicate significant (* P < 0.05) and highly significant (** P < 0.01) differences. The lower case letters indicate a significant differences between two specific genotypes, with a = significant compared with the first genotype of each genetic marker; b = significant compared with the second genotype of each genetic marker; c = significant compared with the third genotype of each genetic marker. The symbol ≠ indicates significant differences in the comparison of before–after pequi-oil supplementation detected by the Wilcoxon matched pairs test

Concerning the influences of the genetic polymorphisms, significant differences before pequi-oil supplementation were presented for ACE, in the values of total leukocytes (P = 0.009) and segmented (0.028); for GSTT1 (P = 0.014) and MTHFR C677T (P = 0.038), in the values of eosinophils; and for GSTT1 (P = 0.001) and MTHFR C677T (P = 0.018), in the values of monocytes. For ACE, significant differences in the number of total leukocytes appeared between ID and DD (P = 0.013) and between ID and II (0.013) genotypes, where ID genotype presented increased values; a similar increase in eosinophils was showed for ID genotype with respect to DD genotype (P = 0.017). For GSTT1, the null genotype presented significantly higher eosinophils (P = 0.014) and monocytes (P = 0.001) compared with non-null genotypes, with the same result occurring with MTHFR677 CT with respect to CC genotype (P = 0.014 for eosinophils; P = 0.007 for monocytes). Although Kruskall–Wallis test detected significant differences between MTHFR1298 genotypes (P = 0.038) in the values of basophils “before”, these were not related to two specific genotypes. After pequi-oil supplementation, no significant differences were observed for ACE polymorphism in the values of total leukocytes or segmented, nor for GSTT1 and MTHFR C677T polymorphisms in the values of monocytes, with only those related to eosinophils remaining (P = 0.047 for GSTT1; P = 0.029 for MTHFR C677T). Nevertheless, for the MTHFR C677T polymorphism, individuals carrying T allele presented increased eosinophils compared with the C homozygous (P = 0.020 between CC and CT; P = 0.049 between CC and TT). Besides these results, other significant differences appeared for CAT, in the values of basophils (P = 0.004); for GSTM1, in the values of rods (P = 0.003); for GSTT1 (P = 0.038) and MTHFR A1298C (P = 0.024), in the values of lymphocytes; and for CRP G1059C, in the values of total leukocytes (P = 0.003), segmented (P = 0.020), and monocytes (P = 0.004). For CAT, basophils showed a significant increase for AT genotype compared with AA (0.001) or TT (P = 0.039) genotypes. Similarly, significant increases in the values of rods were observed for GSTM1 non-null genotypes, while GSTT1 null genotype presented increased lymphocytes. Individuals carrying MTHFR1298 AA (P = 0.043) or CC (P = 0.045) genotypes showed a fall in the number of lymphocytes compared with heterozygous, while the carriers of CRP1059 variant allele presented a significant increase in total leukocytes, segmented, and monocytes (Table 4).

Plateletgram

In the comparison between before and after pequi-oil supplementation, significant differences appeared for Hp 1F-1F (P = 0.036), 1F-1S (P = 0.018), 1F-2 (P = 0.012), and 1S-2 (P = 0.012), MnSOD Val/Val (P = 0.010) and Val/Ala (P = 0.000), CAT TT (P = 0.000), GPx-1 Pro/Pro (P = 0.002) and Pro/Leu (P = 0.001), ACE ID (P = 0.000), GSTM1 null (0.000), GSTT1 null (P = 0.003) and non-null (P = 0.000), CK NcoI AA (P = 0.003) and AG (P = 0.000), CK TaqI 1-2 (P = 0.002) and 2-2 (P = 0.001), CRP GG (P = 0.000), MTHFR677 CC (P = 0.000) and TT (P = 0.001), and MTHFR1298 AA (P = 0.003) and AC (P = 0.000) genotypes in the values of platelets, which fell after pequi-oil treatment. For plateletocrit, the same downward trend occurred after pequi, with significantly decreased values for Hp 1F-1F (P = 0.046), 1F-1S (P = 0.018), 1S-1S (P = 0.022), and 1S-2 (P = 0.022), MnSOD Val/Ala (P = 0.004), CAT TT (P = 0.000), GPx-1 Pro/Pro (P = 0.001) and Pro/Leu (P = 0.035), ACE ID (P = 0.011, GSTM1 null (P = 0.002) and non-null (P = 0.035), GSTT1 null (P = 0.021) and non-null (P = 0.002), CK NcoI AA (P = 0.020) and AG (P = 0.001), CK TaqI 1-2 (P = 0.039) and 2-2 (P = 0.003), CRP GG (P = 0.000), MTHFR677 CC (P = 0.000), and MTHFR1298 AA (P = 0.029) and AC (P = 0.000) genotypes. Significant reductions in mean platelet volume (MPV) values were seen only for Hp 1S-1S (P = 0.018) and ACE ID (P = 0.011) genotypes after pequi treatment, while for platelet distribution width (PDW), a significant increase in the values was observed for Hp 2-2 genotype (P = 0.012; Table 5).
Table 5

Influences of Haptoglobin (Hp), MnSOD, CAT, GPx-1, ACE, GSTM1, GSTT1, CK NcoI, CK TaqI, CRP G1059C, MTHFR C677T and MTHFR A1298C genes’ polymorphisms on the plateletgram before and after pequi-oil supplementation

Genetic markers

Platelet (thousand/mm3)

Plateletocrit (%)

MPV (fl)

PDW (%)

Before

After

Before

After

Before

After

Before

After

Hp

 1F-1F

313.75 ± 13.54

277.38 ± 12.83*,≠

0.31 ± 0.02

0.25 ± 0.01*,≠

10.27 ± 0.60

9.18 ± 0.60

18.18 ± 0.49

17.63 ± 0.37

 1F-1S

324.87 ± 25.18

280.88 ± 22.57*,≠

0.34 ± 0.03

0.27 ± 0.03*,≠

10.59 ± 0.40

9.67 ± 0.35

18.70 ± 0.38

17.6 ± 0.07

 1S-1S

328.42 ± 20.64

306.05 ± 18.46

0.37 ± 0.03

0.32 ± 0.02*,a,≠

11.52 ± 0.50

10.58 ± 0.33*,

18.39 ± 0.31

18.19 ± 0.18

 1F-2

369.35 ± 17.74

339.90 ± 13.66*,

0.37 ± 0.02

0.34 ± 0.02*,a

10.06 ± 0.28*,b,c

9.92 ± 0.32

17.55 ± 0.15

17.71 ± 0.22

 1S-2

332.31 ± 10.98

306.75 ± 11.57*,≠

0.34 ± 0.01

0.31 ± 0.01*,a,≠

10.10 ± 0.28*,c

10.13 ± 0.29

17.83 ± 0.21

18.03 ± 0.20

 2-2

328.97 ± 10.19

320.37 ± 9.86

0.37 ± 0.02

0.36 ± 0.01*,a,b,e

10.76 ± 0.27*,e

11.18 ± 0.33**,a,*,b,d,e

18.07 ± 0.23

18.58 ± 0.20**,b,d,*e,≠

 P values

0.451

0.099

0.566

0.002

0.056

0.023

0.140

0.027

MnSOD

 Val/Val

352.26 ± 16.72

317.58 ± 14.90*,

0.37 ± 0.02

0.32 ± 0.02

10.11 ± 0.35

9.94 ± 0.37

17.77 ± 0.24

17.92 ± 0.29

 Val/Ala

332.88 ± 7.08

312.28 ± 6.66**,≠

0.35 ± 0.01

0.33 ± 0.01**,≠

10.60 ± 0.18

10.47 ± 0.18

18.03 ± 0.12

18.15 ± 0.11

 Ala/Ala

316.00 ± 25.3

289.20 ± 27.99

0.41 ± 0.08

0.31 ± 0.03

10.95 ± 0.27

10.13 ± 0.54

18.48 ± 0.68

17.96 ± 0.22

 P values

0.306

0.563

0.456

0.786

0.261

0.351

0.683

0.618

CAT

 AA

347.59 ± 14.97

326.50 ± 15.01

0.35 ± 0.02

0.32 ± 0.02

10.03 ± 0.31

9.76 ± 0.28

17.78 ± 0.25

18.04 ± 0.22

 AT

337.66 ± 9.52

318.64 ± 8.87

0.36 ± 0.01

0.34 ± 0.01

10.62 ± 0.23

10.67 ± 0.25

17.96 ± 0.15

18.19 ± 0.15

 TT

326.96 ± 10.35

298.55 ± 9.11**,

0.36 ± 0.02

0.31 ± 0.01**,≠

10.68 ± 0.26

10.34 ± 0.26

18.17 ± 0.20

18.04 ± 0.16

 P values

0.434

0.120

0.901

0.235

0.268

0.099

0.380

0.782

GPx-1

 Pro/Pro

348.84 ± 9.96

323.69 ± 9.34**,

0.37 ± 0.01

0.33 ± 0.01**,≠

10.51 ± 0.23

10.16 ± 0.19

17.99 ± 0.15

18.00 ± 0.12

 Pro/Leu

321.1 ± 8.77

298.88 ± 8.23**,≠

0.34 ± 0.01

0.32 ± 0.01*,≠

10.62 ± 0.25

10.59 ± 0.28

18.11 ± 0.19

18.27 ± 0.17

 Leu/Leu

327 ± 16.24

309.77 ± 14.69

0.34 ± 0.02

0.33 ± 0.02

10.31 ± 0.30

10.49 ± 0.48

17.68 ± 0.16

17.94 ± 0.35

 P values

0.346

0.122

0.390

0.535

0.877

0.697

0.640

0.457

ACE

 DD

320.05 ± 10.88

311.21 ± 11.45

0.34 ± 0.01

0.34 ± 0.02

10.80 ± 0.27

10.94 ± 0.31

18.04 ± 0.20

18.31 ± 0.18

 ID

348.32 ± 9.08

313.42 ± 7.98**,≠

0.37 ± 0.01

0.32 ± 0.01**,

10.53 ± 0.21

10.04 ± 0.19*

18.11 ± 0.15

18.00 ± 0.13

 II

328.00 ± 13.67

310.22 ± 12.47

0.32 ± 0.02

0.32 ± 0.01

9.97 ± 0.38

10.22 ± 0.34

17.59 ± 0.24

18.02 ± 0.24

 P values

0.189

0.948

0.081

0.525

0.132

0.082

0.237

0.621

GSTM1

 Null

335.19 ± 6.78

307.97 ± 6.60**,

0.35 ± 0.01

0.32 ± 0.01**,

10.31 ± 0.16

10.25 ± 0.19

17.94 ± 0.12

18.13 ± 0.12

 Non-null

335.40 ± 13.09

319.83 ± 11.63

0.37 ± 0.02

0.34 ± 0.01*,≠

10.97 ± 0.32

10.61 ± 0.27

18.14 ± 0.22

18.06 ± 0.18

 P values

0.621

0.443

0.749

0.135

0.120

0.153

0.519

0.519

GSTT1

 Null

365.53 ± 16.58

329.41 ± 15.32**,≠

0.40 ± 0.03

0.33 ± 0.02*,≠

10.23 ± 0.43

9.86 ± 0.36

18.28 ± 0.37

17.79 ± 0.25

 Non-null

330.23 ± 6.76

309.28 ± 6.40**,≠

0.35 ± 0.01

0.32 ± 0.01**,

10.59 ± 0.16

10.46 ± 0.17

17.96 ± 0.11

18.16 ± 0.11

 P values

0.053

0.302

0.263

0.720

0.262

0.207

0.569

0.197

CK NcoI

 AA

336.88 ± 9.25

315.88 ± 7.29**,≠

0.35 ± 0.01

0.33 ± 0.01*,≠

10.51 ± 0.22

10.29 ± 0.20

17.79 ± 0.16

18.02 ± 0.13

 AG

332.96 ± 9.52

305.47 ± 9.91**,≠

0.36 ± 0.01

0.32 ± 0.01**,

10.55 ± 0.23

10.41 ± 0.26

18.23 ± 0.15*,a

18.09 ± 0.15

 GG

339.50 ± 19.06

334.00 ± 29.86

0.37 ± 0.03

0.37 ± 0.05

10.67 ± 0.49

10.92 ± 0.68

18.08 ± 0.50

18.98 ± 0.40

 P values

0.932

0.728

0.822

0.321

0.888

0.668

0.045

0.103

CK TaqI

 1-1

370.91 ± 36.07

331.36 ± 24.45

0.40 ± 0.04

0.35 ± 0.03

10.29 ± 0.41

10.06 ± 0.30

17.72 ± 0.30

18.20 ± 0.18

 1-2

325.21 ± 7.91

304.90 ± 8.52**,≠

0.34 ± 0.01

0.32 ± 0.01*,

10.53 ± 0.23

10.44 ± 0.24

17.96 ± 0.16

18.03 ± 0.15

 2-2

339.10 ± 8.89

316.36 ± 8.51**,≠

0.37 ± 0.01

0.33 ± 0.01**,≠

10.59 ± 0.23

10.36 ± 0.24

18.12 ± 0.17

18.17 ± 0.15

 P values

0.379

0.310

0.069

0.572

0.894

0.941

0.580

0.493

CRP G1059C

 GG

332.34 ± 6.43

309.26 ± 6.31**,≠

0.35 ± 0.01

0.32 ± 0.01**,

10.54 ± 0.16

10.30 ± 0.15

18.03 ± 0.12

18.05 ± 0.10

 GC

359.15 ± 24.70

335.77 ± 16.05

0.40 ± 0.04

0.37 ± 0.03

10.51 ± 0.39

10.98 ± 0.69

17.83 ± 0.31

18.50 ± 0.34

 P values

0.380

0.180

0.211

0.056

0.819

0.431

0.601

0.151

MTHFR C677T

 CC

324.63 ± 9.52

299.47 ± 8.47**,≠

0.35 ± 0.01

0.31 ± 0.01**,≠

10.73 ± 0.25

10.26 ± 0.23

18.18 ± 0.18

18.06 ± 0.14

 CT

336.83 ± 9.21

323.74 ± 9.26**,a

0.34 ± 0.01

0.33 ± 0.01

10.32 ± 0.21

10.30 ± 0.20

17.76 ± 0.13

18.01 ± 0.14

 TT

370.80 ± 17.73**,a

324.07 ± 16.81**,

0.41 ± 0.03*,a

0.36 ± 0.03*,a

10.49 ± 0.39

11.12 ± 0.64

18.16 ± 0.34

18.59 ± 0.36

 P values

0.016

0.015

0.066

0.047

0.627

0.435

0.312

0.359

MTHFR A1298C

 AA

331.28 ± 8.32

312.60 ± 8.15**,≠

0.35 ± 0.01

0.33 ± 0.01*,≠

10.54 ± 0.20

10.52 ± 0.21

18.00 ± 0.14

18.15 ± 0.13

 AC

343.09 ± 10.15

311.44 ± 8.73**,≠

0.36 ± 0.01

0.32 ± 0.01**,

10.58 ± 0.24

10.21 ± 0.23

18.04 ± 0.18

18.06 ± 0.14

 CC

303.00 ± 6.00

312.50 ± 16.50

0.29 ± 0.04

0.30 ± 0.09

9.50 ± 1.20

9.30 ± 2.10

17.35 ± 0.45

17.60 ± 1.60

 P values

0.539

0.980

0.227

0.748

0.643

0.525

0.686

0.808

Data are expressed as mean ± SEM (standard error of mean) MPV mean platelet volume, PDW platelet deviation weight, fl femtoliters. For GSTM1, GSTT1, and CRP G1059C, P values were generated by the Mann–Whitney U test; for the other genetic markers, P values were generated by the Kruskall–Wallis test. The lower case letters indicate differences between two specific genotypes detected by the Mann–Whitney U test. Asterisks indicate significant (* P < 0.05) and highly significant (** P < 0.01) differences. The lower case letters indicate significant differences between two specific genotypes, with a = significant compared with the first genotype of each genetic marker; b = significant compared with the second genotype of each genetic marker; c = significant compared with the third genotype of each genetic marker. For Hp polymorphism, the lower case letters d, e, and f were also added, with d = significant compared with 1F-2; e = significant compared with 1S-2; and f = significant compared to 2-2 genotypes. The symbol ≠ indicates significant differences in the comparison of before-after pequi-oil supplementation detected by the Wilcoxon matched pairs test

As regards the influence of genetic polymorphisms before pequi-oil supplementation, significant differences appeared only for MTHFR C677T polymorphism in the values of platelets (P = 0.016) and for CK NcoI polymorphism in the values of PDW (P = 0.045). For MTHFR677, significant differences were showed between CC and TT (P = 0.008), with increased platelet values for TT genotypes. For CK NcoI, AG genotype presented higher PDW values compared with AA genotype. Although the Kruskall–Wallis test showed a P value of 0.056 for Hp in the values of MPV “before”, the Mann–Whitney U test detected significant differences between Hp 1S-1S and Hp 1F-2 (P = 0.017), between 1S-1S and 1S-2 (P = 0.012), and between Hp 1S-2 and 2-2 (P = 0.044) in the 2-to-2 comparisons. Similarly, the Mann–Whitney U test also detected a significant difference between Hp 1F-1S and 1F-2 (P = 0.015) in the values of PDW “before”. After pequi-oil supplementation, significant differences were presented for MTHFR C677T (P = 0.015) polymorphism in the values of platelets; for Hp (P = 0.002) and MTHFR C677T (P = 0.047) polymorphisms, in the values of plateletocrit; for Hp (P = 0.023), in the values of MPV; and for Hp (P = 0.027), in PDW values. For MTHFR C677T polymorphism, the number of platelets presented a significant increase in CT genotype compared with CC genotype (P = 0.007), while the plateletocrit values were higher for T homozygous compared with C homozygous (P = 0.032). For Hp polymorphism, significant differences in the plateletocrit values appeared between 1F-1F and 1S-1S (0.025), 1F-1F and 1F-2 (P = 0.005), 1F-1F and 1S-2 (P = 0.025), 1F-1F and 2-2 (P = 0.001), with lower values for 1F-1F; and between 1F-1S and 2-2 (P = 0.017), and 1S-1S and 2-2 (P = 0.008), where 2-2 genotype presented higher values. Significant differences were also seen for MPV values in the comparisons between 1F-1F and 2-2 (P = 0.001), 1F-1S and 2-2 (P = 0.012), 1F-2 and 2-2 (P = 0.038), 1S-2 and 2-2, with higher values for individuals carrying 2-2 genotype. PDW values also presented significant differences between 1F-1S and 2-2 (P = 0.004), 1F-2 and 2-2 (P = 0.006), 1S-2 and 2-2 (P = 0.048) genotypes, with 2-2 genotype maintaining higher values (Table 5).

Postprandial lipid profile

For total cholesterol, significant differences in the comparison of before-after pequi-oil supplementation were showed for MnSOD Ala/Ala (P = 0.016) and GPx-1 Pro/Leu (P = 0.048) genotypes, whose values decreased after pequi-oil supplementation. For triglycerides (TG), differences were detected for Hp 1F-2 (P = 0.044), MnSOD Val/Ala (0.016), CAT AA (0.023), and CK NcoI GG (0.046) genotypes, whose values increased after pequi. Individuals carrying Hp 1F-1F (0.048) genotype presented a significant increase in high-density lipoprotein (HDL) values after supplementation, as did subjects carrying GPx-1 Pro/Pro (0.034) genotype. After pequi treatment, a significant reduction in low-density lipoproteins (LDL) values was showed for GPx-1 Pro/Leu (P = 0.025) genotype, while a significant increase in the very low-density lipoproteins (VLDL) values was observed for Hp 1F-2 (0.044), CAT AA (0.023), and CK NcoI GG (P = 0.046) genotypes (Table 6).
Table 6

Influences of Haptoglobin (Hp), MnSOD, CAT, GPx-1, ACE, GSTM1, GSTT1, CK NcoI, CK TaqI, CRP G1059C, MTHFR C677T, and MTHFR A1298C genes’ polymorphisms on the postprandial lipid profile before and after pequi-oil supplementation

Genetic markers

Total cholesterol (mg/dL)

Triglycerides (mg/dL)

HDL (mg/dL)

LDL (mg/dL)

VLDL (mg/dL)

Before

After

Before

After

Before

After

Before

After

Before

After

Hp

 1F-1F

192.37 ± 13.88

186.88 ± 8.54

165.38 ± 36.12

137.50 ± 20.71

55.50 ± 4.14

59.38 ± 4.42*,≠

103.80 ± 12.99

100.00 ± 7.12

33.08 ± 7.22

27.50 ± 4.14

 1F-1S

184.88 ± 9.42

187.75 ± 9.92

106.88 ± 21.20

111.50 ± 18.72

54.00 ± 3.89

55.13 ± 3.73

109.50 ± 7.75

110.33 ± 8.29

21.38 ± 4.24

22.30 ± 3.74

 1S-1S

178.50 ± 11.91

176.06 ± 10.57

116.33 ± 11.69

128.50 ± 16.56

45.94 ± 3.63

46.61 ± 3.84

109.29 ± 11.21

103.74 ± 9.08

23.27 ± 2.34

25.70 ± 3.31

 1F-2

190.3 ± 8.71

190.45 ± 7.70

98.26 ± 9.77

117.32 ± 12.37*,≠

52.85 ± 2.81

51.50 ± 2.82

115.93 ± 6.44

113.64 ± 6.42

19.65 ± 1.95

23.46 ± 2.47*,≠

 1S-2

186.28 ± 6.60

182.87 ± 6.07

104.44 ± 7,62

115.63 ± 8.17

54.61 ± 1.57

53.21 ± 1.81

111.24 ± 5.69

106.53 ± 5.44

20.89 ± 1.52

23.13 ± 1.63

 2-2

192.36 ± 6.27

195.76 ± 5.91

117.09 ± 12.67

112.76 ± 8.08

59.03 ± 2.67* ,c

60.48 ± 2.61**,c,*e

110.33 ± 4.34

112.49 ± 4.16

23.42 ± 2.53

22.55 ± 1.62

 P values

0.881

0.495

0.562

0.889

0.166

0.011

0.882

0.511

0.562

0.889

MnSOD

 Val/Val

196.05 ± 7.93

193.00 ± 7.95

115.32 ± 14.99

100.53 ± 8.22

57.05 ± 3.96

56.11 ± 3.74

115.94 ± 6.49

116.79 ± 6.53

23.06 ± 3.00

20.11 ± 1.64

 Val/Ala

185.41 ± 4.08

186.27 ± 3.69

111.29 ± 5.75

122.62 ± 5.55* ,≠

53.31 ± 1.30

53.92 ± 1.41

109.72 ± 3.48

107.23 ± 3.05

22.26 ± 1.15

24.53 ± 1.11

 Ala/Ala

198.67 ± 13.73

185.17 ± 10.96* ,≠

134.00 ± 47.03

106.83 ± 29.81

60.33 ± 2.54

58.17 ± 1.70

111.53 ± 5.36

105.63 ± 4.98

26.80 ± 9.41

21.37 ± 5.96

 P values

0.429

0.742

1.000

0.130

0.130

0.390

0.560

0.330

1.000

0.130

CAT

 AA

184.41 ± 7.79

187.82 ± 6.81

98.68 ± 11.13

128.27 ± 14.16*,

49.27 ± 2.67

48.41 ± 2.35

116.30 ± 7.64

113.45 ± 7.18

19.74 ± 2.23

25.66 ± 2.83*,

 AT

189.86 ± 5.95

188.61 ± 4.85

120.74 ± 10.21

117.44 ± 7.26

55.53 ± 1.80

56.45 ± 2.03

109.41 ± 4.69

107.83 ± 3.72

24.15 ± 2.04

23.49 ± 1.45

 TT

187.09 ± 5.23

185.57 ± 5.54

111.67 ± 7.26

114.37 ± 6.84

55.19 ± 2.02

55.17 ± 2.01

109.86 ± 4.28

107.47 ± 4.32

22.34 ± 1.45

22.87 ± 1.37

 P values

0.849

0.912

0.383

0.956

0.274

0.117

0.886

0.868

0.383

0.956

GPx-1

 Pro/Pro

187.14 ± 5.09

190.45 ± 4.66

117.12 ± 8.60

119.63 ± 6.71

54.76 ± 1.93

56.49 ± 1.91* ,≠

108.70 ± 4.10

109.07 ± 3.65

23.43 ± 1.72

23.93 ± 1.34

 Pro/Leu

189.09 ± 5.55

183.55 ± 5.22

106.34 ± 6.61

117.81 ± 8.29

53.28 ± 1.85

51.68 ± 1.99

114.54 ± 5.07

108.31 ± 4.60*,≠

21.27 ± 1.32

23.56 ± 1.66

 Leu/Leu

186.07 ± 11.21

186.71 ± 8.59

119.36 ± 22.86

114.21 ± 12.62

55.36 ± 2.07

55.36 ± 2.54

106.84 ± 6.90

108.51 ± 6.55

23.87 ± 4.57

22.84 ± 2.52

 P values

0.953

0.608

0.948

0.790

0.828

0.363

0.810

0.787

0.948

0.790

ACE

 DD

178.44 ± 5.97

178.41 ± 5.01

107.71 ± 10.01

116.83 ± 8.20

54.43 ± 2.20

55.21 ± 2.21

102.98 ± 3.95

99.27 ± 3.65

21.54 ± 2.00

23.37 ± 1.64

 ID

197.22 ± 5.01*,a

194.86 ± 4.78

116.26 ± 8.11

119.90 ± 7.29

54.64 ± 1.75

54.81 ± 1.90

118.80 ± 4.65* ,a

115.49 ± 4.12**,a

23.25 ± 1.62

23.98 ± 1.46

 II

178.63 ± 7.80

182.89 ± 7.46

115.05 ± 11.59

116.37 ± 10.19

52.63 ± 2.49

51.79 ± 2.35

102.99 ± 6.39

107.83 ± 5.80

23.01 ± 2.32

23.27 ± 2.04

 P values

0.029

0.057

0.461

0.911

0.880

0.779

0.047

0.024

0.461

0.911

GSTM1

 Null

192.33 ± 4.50

190.22 ± 4.00

110.27 ± 7.04

114.19 ± 5.77

55.14 ± 1.60

55.37 ± 1.61

114.67 ± 3.78

111.50 ± 3.31

22.06 ± 1.41

22.84 ± 1.15

 Non-null

179.12 ± 5.47

181.71 ± 5.37

118.39 ± 9.15

125.90 ± 8.66

52.60 ± 1.78

52.81 ± 2.01

103.42 ± 4.39

103.31 ± 4.30

23.68 ± 1.83

25.18 ± 1.73

 P values

0.076

0.210

0.291

0.224

0.194

0.239

0.065

0.205

0.291

0.224

GSTT1

 Null

193.25 ± 6.89

189.44 ± 6.83

145.12 ± 16.9

143.81 ± 14.92

52.88 ± 3.20

53.63 ± 4.09

111.35 ± 6.65

107.05 ± 5.22

29.03 ± 3.38

28.76 ± 2.98

 Non-null

186.93 ± 3.94

186.95 ± 3.57

108.07 ± 5.76*,a

114.25 ± 4.99* ,a

54.46 ± 1.32

54.61 ± 1.32

110.74 ± 3.25

108.96 ± 2.95

21.61 ± 1.15* ,a

22.85 ± 1.00* ,a

 P values

0.544

0.793

0.017

0.031

0.988

0.616

0.824

0.956

0.017

0.031

CK NcoI

 AA

189.62 ± 4.32

184.72 ± 4.19

118.90 ± 8.20

113.75 ± 6.33

52.49 ± 1.45

51.52 ± 1.52

113.62 ± 4.05

110.47 ± 3.88

23.78 ± 1.64

22.75 ± 1.27

 AG

186.58 ± 6.11

189.60 ± 5.32

107.69 ± 7.99

121.71 ± 7.59

56.28 ± 2.07

57.72 ± 2.13

108.17 ± 4.66

106.47 ± 3.86

21.54 ± 1.60

24.34 ± 1.52

 GG

180.00 ± 14.11

192.50 ± 12.08

101.83 ± 24.04

133.50 ± 28.11* ,≠

54.17 ± 6.06

55.83 ± 5.26

105.47 ± 9.75

109.97 ± 9.97

20.37 ± 4.81

26.70 ± 5.62* ,≠

 P values

0.809

0.713

0.543

0.618

0.406

0.067

0.624

0.979

0.543

0.618

CK TaqI

 1-1

198.00 ± 7.70

191.17 ± 9.04

129.50 ± 21.22

123.50 ± 12.82

55.58 ± 4.47

53.42 ± 4.48

116.52 ± 8.09

113.05 ± 8.07

25.90 ± 4.24

24.70 ± 2.56

 1-2

185.04 ± 5.46

184.30 ± 4.64

106.27 ± 7.46

115.00 ± 6.61

54.00 ± 1.94

53.98 ± 1.99

110.30 ± 4.66

107.07 ± 3.67

21.25 ± 1.49

23.00 ± 1.32

 2-2

188.39 ± 5.39

189.65 ± 5.13

116.80 ± 8.84

120.66 ± 8.19

54.22 ± 1.58

55.27 ± 1.71

110.04 ± 4.22

109.45 ± 4.32

23.36 ± 1.77

24.13 ± 1.64

 P values

0.570

0.680

0.327

0.701

0.942

0.857

0.680

0.732

0.327

0.701

CRP G1059C

 GG

186.33 ± 3.72

185.17 ± 3.40

113.89 ± 6.04

117.83 ± 5.00

54.02 ± 1.29

54.00 ± 1.35

109.41 ± 3.11

107.06 ± 2.79

22.78 ± 1.21

23.57 ± 1.00

 GC

199.62 ± 11.08

204.54 ± 8.89

106.69 ± 14.05

121.77 ± 17.61

56.15 ± 3.73

58.38 ± 3.64

122.12 ± 8.59

121.80 ± 7.61

21.34 ± 2.81

24.35 ± 3.52

 P values

0.243

0.060

0.973

0.867

0.518

0.145

0.146

0.055

0.973

0.867

MTHFR C677T

 CC

187.31 ± 5.20

185.64 ± 4.71

110.75 ± 8.18

116.51 ± 7.38

52.89 ± 1.60

53.11 ± 1.72

112.86 ± 4.80

109.02 ± 4.02

22.15 ± 1.64

23.30 ± 1.48

 CT

187.98 ± 5.79

190.12 ± 5.10

115.00 ± 8.77

121.15 ± 7.56

56.08 ± 2.09

56.19 ± 2.24

108.02 ± 4.28

108.86 ± 4.15

23.00 ± 1.75

24.23 ± 1.51

 TT

188.81 ± 9.02

184.44 ± 9.16

115.56 ± 16.26

115.81 ± 12.19

53.50 ± 3.56

54.13 ± 2.98

112.20 ± 6.79

107.15 ± 6.83

23.11 ± 3.25

23.16 ± 2.44

 P values

0.990

0.766

0.858

0.773

0.653

0.767

0.735

0.980

0.858

0.773

MTHFR A1298C

 AA

189.15 ± 4.69

187.17 ± 4.14

119.32 ± 7.84

125.41 ± 6.55

55.85 ± 1.54

55.51 ± 1.56

109.07 ± 3.62

105.95 ± 3.28

23.87 ± 1.57

25.08 ± 1.31

 AC

185.27 ± 5.60

187.00 ± 5.38

102.51 ± 7.63

103.42 ± 6.36* ,a,c

52.07 ± 2.01

53.20 ± 2.22

113.06 ± 5.19

112.96 ± 4.58

20.50 ± 1.53

20.68 ± 1.27* ,a,c

 CC

195.00 ± 16.00

198.00 ± 9.00

130.00 ± 2.00

198.50 ± 30.50

45.00 ± 3.00

45.50 ± 2.50

124.00 ± 12.60

112.80 ± 12.60

26.00 ± 0.40

39.70 ± 6.10

 P values

0.841

0.911

0.212

0.010

0.181

0.265

0.641

0.659

0.212

0.010

Data are expressed as mean ± SEM (standard error of mean). For GSTM1, GSTT1 and CRP G1059C, P values were generated by the independent samples t-Test (total cholesterol) or Mann–Whitney U test (other variables); for the other genetic markers, P values were generated by ANOVA (total cholesterol) or by the Kruskall–Wallis test (other variables). Asterisks indicate significant (* P < 0.05) and highly significant (** P < 0.01) differences. The lower case letters indicate significant differences between two specific genotypes, with a = significant compared with the first genotype of each genetic marker; b = significant compared with the second genotype of each genetic marker; c = significant compared with the third genotype of each genetic marker. For Hp polymorphism, the lower case letters d, e, and f were also added, with d = significant compared with 1F-2; e = significant compared with 1S-2; and f = significant compared with 2-2 genotypes. The symbol ≠ indicates significant differences in the comparison of before-after pequi-oil supplementation detected by the Wilcoxon matched pairs test

Regarding genetic markers, significant differences between the genotypes before pequi-oil supplementation were showed for ACE (0.029), in the values of total cholesterol; for GSTT1, in the values of TG and VLDL (0.017 for both); and for ACE (P = 0.024), in the values of LDL. ACE ID genotype presented higher total cholesterol (P = 0.047) and LDL (0.022) values than DD genotype and similar results of increased TG were observed for GSTT1 null genotype. After pequi-oil treatment, no significant difference in the values of total cholesterol was observed between ACE genotypes, but ID genotype kept significantly higher values of LDL than did DD genotype (P = 0.007). GSTT1 null genotype also kept higher values of TG (P = 0.031) and VLDL (P = 0.031) than non-null genotype. Similar increased TG were observed for MTHFR1298 AA (P = 0.019) and CC (P = 0.022) compared with AC genotype, and the same occurred with VLDL (P = 0.019 for AA; P = 0.022 for CC). For HDL, values were higher for Hp 2-2, compared with Hp 1S-1S (P = 0.003) and 1S-2 (0.033; Table 6).

CRP and hs-CRP

CRP values increased significantly after pequi-oil supplementation for individuals carrying MTHFR1298 AC genotype (0.024). However, before pequi treatment, MTHFR1298 AA genotype presented higher CRP values than AC genotype (P = 0.002). For MTHFR677, although the Kruskall–Wallis test did not show significant differences between MTHRF677 genotypes before pequi-oil supplementation, the Mann–Whitney U test indicated differences between CC and TT genotypes in CRP values (P = 0.026), which were significantly higher for TT genotype. After pequi, no significant differences were observed between these genotypes (Table 7).
Table 7

Influences of Haptoglobin (Hp), MnSOD, CAT, GPx-1, ACE, GSTM1, GSTT1, CK NcoI, CK TaqI, CRP G1059C, MTHFR C677T, and MTHFR A1298C genes’ polymorphisms on the CRP, hs-CRP, arterial pressure and TBARS assay before and after pequi-oil supplementation

Genetic Markers

CRP (mg/dL)

hs-CRP (mg/dL)

Systolic pressure (mmHg)

Diastolic pressure (mmHg)

TBARS (nmol/mL of MDA)

Before

After

Before

After

Before

After

Before

After

Before

After

Hp

 1F-1F

0.24 ± 0.07

0.31 ± 0.11

1.02 ± 0.27

1.41 ± 0.53

111.43 ± 4.59

112.86 ± 2.86

68.57 ± 4.04

65.71 ± 2.97

0.029 ± 0.003

0.030 ± 0.002

 1F-1S

0.28 ± 0.12

0.35 ± 0.09

1.97 ± 0.80

1.39 ± 0.39

120.00 ± 1.89

115.00 ± 1.89*,≠

77.50 ± 3.13

72.50 ± 2.50

0.032 ± 0.002

0.030 ± 0.003

 1S-1S

0.30 ± 0.05

0.37 ± 0.07

1.49 ± 0.51

1.95 ± 0.43

116.00 ± 1.97

111.00 ± 1.76*,≠

73.50 ± 1.67

69.00 ± 1.76

0.023 ± 0.001*,b

0.025 ± 0.001

 1F-2

0.32 ± 0.08

0.38 ± 0.07

1.70 ± 0.50

2.00 ± 0.65

115.26 ± 1.77

113.16 ± 2.17

71.05 ± 2.28

70.00 ± 1.87

0.028 ± 0.002

0.026 ± 0.002

 1S-2

0.36 ± 0.06

0.36 ± 0.05

1.37 ± 0.38

1.34 ± 0.33

116.88 ± 1.23

111.87 ± 1.76*,≠

72.19 ± 1.54

68.12 ± 1.45

0.029 ± 0.001

0.026 ± 0.001

 2-2

0.36 ± 0.07

0.38 ± 0.06

1.82 ± 0.46

1.36 ± 0.24

112.50 ± 1.00

111.87 ± 1.14

73.13 ± 1.52

69.69 ± 1.52

0.024 ± 0.001

0.025 ± 0.001

 P values

0.827

0.969

0.912

0.604

0.060

0.680

0.358

0.599

0.005

0.249

MnSOD

 Val/Val

0.34 ± 0.06

0.33 ± 0.04

1.38 ± 0.37

1.62 ± 0.31

116.50 ± 1.67

110.50 ± 1.85*,≠

71.00 ± 2.16

68.50 ± 1.82

0.031 ± 0.002

0.028 ± 0.002

 Val/Ala

0.33 ± 0.04

0.37 ± 0.03

1.59 ± 0.24

1.54 ± 0.20

114.95 ± 0.79

112.69 ± 0.85*,≠

73.01 ± 0.89

69.35 ± 0.84*,≠

0.026 ± 0.001*,a

0.026 ± 0.001

 Ala/Ala

0.30 ± 0.11

0.60 ± 0.31

2.58 ± 0.99

1.51 ± 0.52

114.00 ± 4.00

110.00 ± 3.16

72.00 ± 4.90

68.00 ± 4.90

0.026 ± 0.003

0.026 ± 0.003

 P values

0.885

0.872

0.398

0.478

0.786

0.501

0.575

0.853

0.024

0.493

CAT

 AA

0.33 ± 0.05

0.42 ± 0.08

1.97 ± 0.54

2.10 ± 0.60

115.22 ± 1.65

110.87 ± 1.39*,≠

70.87 ± 1.65

69.13 ± 1.65

0.027 ± 0.001

0.027 ± 0.001

 AT

0.35 ± 0.05

0.39 ± 0.05

1.39 ± 0.30

1.31 ± 0.21

114.58 ± 1.07

111.46 ± 1.33*,≠

73.75 ± 1.32

69.79 ± 1.21*,≠

0.026 ± 0.001

0.025 ± 0.001

 TT

0.31 ± 0.05

0.33 ± 0.03

1.61 ± 0.33

1.56 ± 0.23

115.74 ± 1.13

113.62 ± 1.11

72.34 ± 1.30

68.51 ± 1.18*,≠

0.027 ± 0.001

0.028 ± 0.001

 P values

0.877

0.735

0.344

0.262

0.628

0.212

0.332

0.740

0.837

0.133

GPx-1

 Pro/Pro

0.36 ± 0.05

0.34 ± 0.04

2.12 ± 0.38

1.57 ± 0.23

115.69 ± 0.99

112.76 ± 1.15*,≠

73.97 ± 1.04

68.97 ± 1.03*,≠

0.027 ± 0.001

0.026 ± 0.001

 Pro/Leu

0.29 ± 0.03

0.38 ± 0.04

1.08 ± 0.17

1.69 ± 0.31

115.53 ± 1.13

111.06 ± 1.02**,≠

71.28 ± 1.35

68.94 ± 1.23*,≠

0.027 ± 0.001

0.026 ± 0.001

 Leu/Leu

0.32 ± 0.06

0.45 ± 0.12

1.04 ± 0.22

0.97 ± 0.22

111.54 ± 1.91

113.85 ± 2.67

71.54 ± 2.96

70.77 ± 2.39

0.027 ± 0.002

0.026 ± 0.002

 P values

0.851

0.542

0.118

0.507

0.227

0.377

0.204

0.726

0.998

0.912

ACE

 DD

0.33 ± 0.06

0.39 ± 0.05

1.72 ± 0.42

1.57 ± 0.28

113.33 ± 1.06

111.54 ± 1.01

71.03 ± 1.41

68.46 ± 1.25

0.027 ± 0.001

0.026 ± 0.001

 ID

0.33 ± 0.04

0.34 ± 0.03

1.55 ± 0.27

1.55 ± 0.25

115.67 ± 1.02

112.83 ± 1.01*,≠

72.67 ± 1.11

70.00 ± 1.01

0.027 ± 0.001

0.027 ± 0.001

 II

0.34 ± 0.05

0.43 ± 0.08

1.41 ± 0.33

1.49 ± 0.41

117.37 ± 1.85

111.58 ± 2.79*,≠

75.79 ± 2.07

67.89 ± 2.24**,≠

0.026 ± 0.002

0.026 ± 0.001

 P values

0.590

0.653

0.993

0.922

0.141

0.448

0.206

0.407

0.840

0.639

GSTM1

 Null

0.36 ± 0.04

0.36 ± 0.03

1.83 ± 0.30

1.54 ± 0.19

115.26 ± 0.93

112.50 ± 0.90*,≠

72.63 ± 1.05

69.61 ± 0.98*,≠

0.027 ± 0.001

0.027 ± 0.001

 Non-null

0.27 ± 0.03

0.38 ± 0.05

1.12 ± 0.18

1.57 ± 0.33

115.00 ± 1.04

111.67 ± 1.36*,≠

72.62 ± 1.28

68.33 ± 1.13*,≠

0.025 ± 0.001

0.026 ± 0.001

 P values

0.443

0.902

0.513

0.652

0.978

0.674

0.915

0.503

0.183

0.436

GSTT1

 Null

0.33 ± 0.06

0.27 ± 0.06

1.68 ± 0.47

1.30 ± 0.44

114.71 ± 2.12

111.76 ± 2.14

70.00 ± 2.10

68.82 ± 2.08

0.029 ± 0.001

0.027 ± 0.002

 Non-null

0.33 ± 0.03

0.38 ± 0.03

1.57 ± 0.23

1.59 ± 0.18

115.25 ± 0.74

112.28 ± 0.81**,≠

73.07 ± 0.88

69.21 ± 0.80**,≠

0.026 ± 0.001

0.026 ± 0.001

 P values

0.665

0.083

0.409

0.492

0.825

0.851

0.216

0.864

0.152

0.791

CK NcoI

 AA

0.35 ± 0.05

0.38 ± 0.04

1.63 ± 0.33

1.74 ± 0.27

115.25 ± 0.92

111.97 ± 0.87*,≠

73.11 ± 1.11

69.02 ± 1.01**,≠

0.026 ± 0.001

0.027 ± 0.001

 AG

0.32 ± 0.04

0.36 ± 0.04

1.63 ± 0.29

1.47 ± 0.23

115.10 ± 1.10

111.76 ± 1.33*,≠

71.76 ± 1.24

69.02 ± 1.20

0.028 ± 0.001

0.026 ± 0.001

 GG

0.25 ± 0.09

0.33 ± 0.05

0.85 ± 0.30

0.59 ± 0.12

115.00 ± 4.28

118.33 ± 3.07

75.00 ± 4.28

71.67 ± 3.07

0.026 ± 0.003

0.026 ± 0.002

 P values

0.836

0.939

0.737

0.287

0.976

0.157

0.635

0.682

0.276

0.780

CK TaqI

 1-1

0.37 ± 0.08

0.43 ± 0.08

1.60 ± 0.49

2.11 ± 0.50

117.27 ± 2.37

110.91 ± 2.11*,≠

77.27 ± 2.73

72.73 ± 2.37

0.026 ± 0.002

0.028 ± 0.002

 1-2

0.30 ± 0.04

0.40 ± 0.05

1.29 ± 0.24

1.71 ± 0.30

115.00 ± 0.93

111.90 ± 1.06*,≠

71.55 ± 1.04

67.93 ± 1.07*,≠

0.026 ± 0.001

0.026 ± 0.001

 2-2

0.35 ± 0.06

0.32 ± 0.02

1.91 ± 0.39

1.26 ± 0.16

114.90 ± 1.17

112.86 ± 1.24

72.86 ± 1.37

69.80 ± 1.15

0.028 ± 0.001

0.027 ± 0.001

 P values

0.828

0.625

0.362

0.157

0.701

0.617

0.161

0.128

0.341

0.638

CRP G1059C

 GG

0.34 ± 0.03

0.37 ± 0.03

1.67 ± 0.23

1.60 ± 0.18

115.14 ± 0.73

112.19 ± 0.83**,≠

72.48 ± 0.85

69.43 ± 0.78**,≠

0.027 ± 0.001

0.026 ± 0.001

 GC

0.27 ± 0.06

0.35 ± 0.08

0.86 ± 0.25

1.14 ± 0.45

115.38 ± 2.43

112.31 ± 1.22

73.85 ± 2.67

66.92 ± 2.63

0.025 ± 0.002

0.026 ± 0.002

 P values

0.645

0.785

0.144

0.103

0.974

0.996

0.568

0.197

0.349

0.666

MTHFR C677T

 CC

0.28 ± 0.05

0.36 ± 0.04

1.30 ± 0.29

1.49 ± 0.24

115.18 ± 1.05

111.43 ± 1.12**,≠

72.50 ± 1.20

68.93 ± 0.94*,≠

0.028 ± 0.001

0.027 ± 0.001

 CT

0.36 ± 0.05

0.39 ± 0.05

1.76 ± 0.33

1.74 ± 0.31

115.00 ± 1.02

112.61 ± 1.22

72.39 ± 1.21

68.48 ± 1.20*,≠

0.025 ± 0.001

0.026 ± 0.001

 TT

0.39 ± 0.05*,a

0.33 ± 0.04

1.99 ± 0.61

1.19 ± 0.24

115.63 ± 2.23

113.75 ± 1.80

73.75 ± 2.56

71.88 ± 2.77

0.026 ± 0.002

0.023 ± 0.002

 P values

0.063

0.992

0.648

0.944

0.899

0.670

0.879

0.557

0.133

0.079

MTHFR A1298C

 AA

0.38 ± 0.04

0.38 ± 0.04

1.65 ± 0.26

1.49 ± 0.22

115.35 ± 0.82

112.68 ± 0.98*,≠

72.82 ± 1.05

68.73 ± 0.96**,≠

0.027 ± 0.001

0.026 ± 0.001

 AC

0.25 ± 0.04**,a

0.35 ± 0.04*

1.51 ± 0.36

1.71 ± 0.28

114.67 ± 1.30

111.33 ± 1.21*,≠

72.22 ± 1.34

69.56 ± 1.23

0.026 ± 0.001

0.027 ± 0.001

 CC

0.34 ± 0.16

0.33 ± 0.18

0.67 ± 0.07

0.56 ± 0.06

120.00 ± 0.00

115.00 ± 5.00

75.00 ± 5.00

75.00 ± 5.00

0.036 ± 0.001

0.034 ± 0.004

 P values

0.006

0.760

0.397

0.727

0.511

0.692

0.894

0.459

0.123

0.208

Data are expressed as mean ± SEM (standard error of mean). MDA = malondialdehyde. For GSTM1, GSTT1 and CRP G1059C, P values were generated by the independent samples t-Test (Tbars assay) or Mann–Whitney U test (other variables); for the other genetic markers, P values were generated by ANOVA (Tbars assay) or by the Kruskall–Wallis test (other variables). Asterisks indicate significant (* P < 0.05) and highly significant (** P < 0.01) differences. The lower case letters indicate significant differences between two specific genotypes, with a = significant compared with the first genotype of each genetic marker; b = significant compared with the second genotype of each genetic marker; c = significant compared with the third genotype of each genetic marker. For Hp polymorphism, the lower case letters d, e, and f were also added, with d = significant compared with 1F-2; e = significant compared with 1S-2; and f = significant compared with 2-2 genotypes. The symbol ≠ indicates significant differences in the comparison of before-after pequi-oil supplementation detected by the Wilcoxon matched pairs test

Arterial pressure

There are downward trends to reduced systolic and diastolic pressures after pequi-oil supplementation. Significant decreases in systolic pressure were observed for Hp 1F-1S (P = 0.046), 1S-1S (P = 0.047), and 1S-2 (P = 0.016); for MnSOD Val/Val (0.018) and Val/Ala (P = 0.021); for CAT AA (P = 0.032) and AT (P = 0.026); for GPx-1 Pro/Pro (P = 0.026) and Pro/Leu (P = 0.002); for ACE ID (P = 0.035) and II (P = 0.012); for GSTM1 null (P = 0.021) and non-null (0.011); for GSTT1 non-null (P = 0.002); for CK NcoI AA (P = 0.011) and AG (P = 0.010); for CK TaqI 1-1 (P = 0.035) and 1-2 (P = 0.011); for CRP GG (P = 0.002); for MTHFR677 CC (P = 0.006); and for MTHFR1298 AA (P = 0.013) and AC (P = 0.042) genotypes. For diastolic pressure, significant reduction after pequi was observed for MnSOD Val/Ala (P = 0.003); for CAT AT (P = 0.033) and TT (P = 0.011); for GPx-1 Pro/Pro (P = 0.003); for GSTM1 null (P = 0.026) and non-null (P = 0.017); for GSTT1 non-null (P = 0.001); for CK NcoI AA (P = 0.007); for CK TaqI 1-2 (P = 0.023); for CRP GG (P = 0.007); for MTHFR677 CC (P = 0.013) and CT (P = 0.025); and for MTHFR1298 AA (P = 0.002) genotypes. However, no significant differences were observed between genotypes before or after pequi-oil supplementation (Table 7).

TBARS assay

No significant differences were observed in MDA values in the comparison of before-after pequi-oil treatment. However, Hp (0.005) and MnSOD (P = 0.024) polymorphisms presented significant differences between genotypes before supplementation. Hp 1F-1S showed higher MDA values than 1S-1S (P = 0.019), and the same occurred with MnSOD Val/Val compared with Val/Ala (P = 0.019). After pequi, no significant differences between genotypes were observed (Table 7).

Discussion

The integration of genomics into nutritional sciences has illuminated the complexity of genome responses to nutritional exposures, offering opportunities to increase the effectiveness of nutritional interventions [126]. Dietary chemicals can affect gene expression directly or indirectly to act as ligands for transcription factor receptors, to be metabolized by primary or secondary metabolic pathways, altering concentrations of substrates or intermediates, or to affect signal pathways positively or negatively [63]. Thus, nutrients elicit multiple physiological responses that affect genome stability, imprinting, expression, and viability [126]. These effects confer both health benefits and risks, some of which may not become apparent until later in life [63, 126], besides potentially being able to affect athletic performance [49]. Other reports with lower or equal intervention times have also shown physiological effects, with significant changes in the used markers [16, 48, 66, 77, 104]. Pequi oil is composed mostly of oleic acid and palmitic acid, which are involved in modulating the ratio of triacylglycerol to cholesterol in postprandial lipemia, as well as cell viability and cycling in human monocytes [77]. It also contains several carotenoids, recognized as an effective antioxidant under low PO2 conditions [17, 43] such those undergone by various tissues and organs during races. In addition, it has been reported that a postprandial monounsaturated fattyacid–rich meal (such as those provided by the Mediterranean diet and by pequi-oil supplementation) increases both plasma carotenoids and human serum paraoxoanase activity (PON1) with a decrease in CRP levels [16]. It has also been suggested that an increased intake of monounsaturated fatty acids is inversely related to blood pressure [125], and our previous report corroborates all these reports and suggestions [88]. Hence, the present study can help broaden knowledge of how antioxidant supplementation affects a person’s genes and how individual athletic genetic makeup can affect the way athletes respond to antioxidant supplementation.

As previously mentioned, genes have been implicated in the levels of oxidative stress, lipids, CVD risk, immune reactivity, and performance [12, 15, 18, 20, 22, 23, 34, 36, 42, 45, 55, 62, 68, 69, 78, 85, 95, 147]. Although it is difficult for any study to control all the involved variables, the following were controlled in this study: (1) only trained sportsmen were included; (2) the athletes could choose the distance that they would cover, according to the type, intensity and length of weekly training, guaranteeing no additional physical stress beyond what they are accustomed to; (3) the volunteers were grouped for distance chosen, so that the same route was covered in both races inside the same time for each group of athletes, guaranteeing also the same intensity (time needed to finish the races); (4) although the athletes had a variable degree of training intensity, the amount of training per week was similar (in number of days and hours of training); (5) the volunteers ran the same distance in both races in the same sample time interval and under the same environmental conditions; consequently, the same plasma expansion would be expected in both races; (6) the only change in the athletes’ routine between the two races was the supplementation with pequi oil; (7) for the analyzed parameters, differences between sexes are not considered for clinical purposes [46, 67, 137]; (8) for the lipid profile, differences between age groups (up to and from 19 years old) are only clinically considered in fasting [46]; we, however, worked with postprandial lipid profile, and the sample size of this age group was only 20 individuals, which we consider too small to influence the overall result, mainly because there was no correlation between age groups and the analyzed genetic markers. Thus, the significant differences presented in this study are more likely to be related to the pequi-oil supplementation affecting genes/alleles and the genetic factors affecting responses to this supplementation than to the differences between sexes, age, training amount, or intensity.

It is a well-known fact that blood parameters vary in accordance with the stress, duration, and type of exercise. There can be changes in blood values during and after intensive exercise caused by differences such as the state of individual training, environmental factors, and nutrition [14, 35, 41, 71, 135, 139], and the only change in the athletes’ routine between the two races was the supplementation with pequi oil. Moreover, previous results of our group which investigated the antioxidant effects of pequi oil on the same runners through measurements of creatine kinase (CK), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) [89] corroborate the suggestion above, since they did not exceed the reference values proposed for clinical purposes [46, 67, 120] and much less for athletes [96] in both before and after pequi-oil supplementation, besides reducing DNA damage after pequi. Additionally, in the immediate post-exercise period an increment of 50–100% of total leukocytes occurs, mainly due to neutrophilia and lymphopenia, as well as monocytosis, which also occurs at a lower rate [35], and results of leukogram and plateletgram were inside the reference values [67, 137] after both races, independently of sex, age group, or distance covered. As the effects of pequi oil on leukogram, plateletgram, posprandial lipid profile, CRP, and arterial pressure have been previously reported and discussed [88], including correlations between sex/age group, sex/distance covered, and age group/distance covered, we will not discuss them here.

Hp polymorphism has been suggested as a candidate genetic marker in essential hypertension [39] and showed playing a role in predicting an individual’s total serum cholesterol [22] and HDL levels [18]. Hp *1 allele frequency (when it is treated as a single block, without differentiating Hp 1F or 1S) is high among patients with essential hypertension [40, 92]. Our study was carried out with athletes. However, the different responses obtained for Hp 1F and 1S alleles, even before pequi-oil supplementation, as well as the significant deviation from HWE (which disappeared when these alleles are considered as a single block), indicates that there are differences in biological responses among the Hp *1 alleles and that they cannot be treated as a single block in the association studies.

Our study also indicates that before pequi-oil supplementation, lipid peroxidation (evaluated by the Tbars assay) can perhaps be the main predisposition factor for essential hypertension associated with Hp *1 allele. It also suggests that Hp 1F-1S genotype may contribute to spurious associations with Hp *1 allele. Nevertheless, after pequi-oil supplementation, the responses became more homogeneous and no more significant differences were observed among Hp genotypes, demonstrating that the supplement’s protective antioxidant effects affected differential responses to the exercise-induced lipid peroxidation. On the other hand, the Hp 2-2 genotype has been associated with increased risk for essential hypertension [107] and with accumulation of atherosclerotic lesions in essential hypertension, besides showing higher therapeutic needs and more refractory hypertension [40]. Hp 2-2 has been also associated with increased CVD risk, mainly in patients with diabetes [69, 73, 114]. Because atherosclerosis is an inflammatory disease, strenuous exercise can exacerbate this condition and favor atherosclerosis and cardiovascular risk, increasing oxidative stress in the vascular endothelium, blood viscosity, and leukocytosis [70, 118, 119]. In addition, evidence has emerged indicating interactions between neutrophils and platelets and suggesting an ability of platelets to enhance neutrophil-induced endothelial dysfunction [60]. It is noteworthy that (1) HDL has direct anti-atherothrombotic properties that result from inhibition of platelet aggregation, reduced blood viscosity, and suppression of platelet activation factors [83, 86, 115] and (2) in our study, no significant differences in the analyzed biochemical profiles or arterial pressure were found before pequi-oil treatment, but after pequi the Hp 2-2 was differentiated from other Hp genotypes, particularly in the plateletgram, despite having higher HDL values (“good cholesterol”). These results suggested that such associations may be related to increased platelet activation for this genotype in response to the lipid diet rather than to the lipid profile alone. In this context, increased dietary ingestion of lipids for individuals carrying Hp 2-2 genotype could increase thrombolytic effects, contributing to CVD events. Evidence to support this includes the fact that MPV is an indicator of platelet activation [117], and Hp 2-2 presented higher plateletocrit, MPV, and PDW values than any of the other Hp genotypes after pequi-oil supplementation.

Because reactive oxygen species (ROS) play a pivotal role in the pathogenesis of endothelial dysfunction [26], which may involve the development of hypertension and coronary artery disease [74], polymorphisms in the antioxidant enzymes’ genes and glutathione S-transferases (GSTs) should also be better analyzed in this context. Whereas antioxidant enzymes act by directly neutralizing ROS [43, 57], most GST substrates are xenobiotics or products of oxidative stress [36].

At the cellular and molecular levels, the endothelium is a likely central focus for the effects of hypertension and the pathogenesis of atherosclerosis [4]. It has even been suggested that superoxide anions might trigger the development of hypertension in some models, presumably by inactivating endothelium-derived nitric oxide and thus mitigating this important vasodilator mechanism [4, 98]. Thus, the polymorphisms in the MnSOD gene can affect superoxide dismutase enzyme efficiency against oxidative stress due to superoxide production in the vascular endothelium, in turn favoring hypertension. Similarly to the Hp polymorphism, before pequi the Val/Val genotype presented higher MDA values than did Val/Ala genotypes, a fact that may contribute to the significant deviation from HWE in favor of heterozygous. Deviations from HWE might be explained by natural selection or recent ethnic admixture [121], but the latter is not the case of our population, although miscegenation continues to occur. Because natural selection can act at the level of genes, if particular genotypes allow for increased fitness in specific environments [11], results suggest a possible adaptive advantage for MnSOD heterozygosis for our population. Further, they are in accordance with results obtained by our research group with other population groups from Brasília [58, 92]. Although the variant −9Ala allele has been associated with diseases related to oxidative stress and abnormal free radical defense mechanisms [2, 31, 94, 102], our results are not contrary to these findings: the small sample size and also the large standard deviation of the Ala/Ala genotype were already expected, because we worked with athletes. So these aspects made any significant difference in the used markers impossible when it was compared with other genotypes. Moreover, while another area of the MnSOD gene or another unknown gene located in its close vicinity of the MnSOD gene should also be taken into account, heterozygote gives a selective advantage in the global aspect of diseases. However, after pequi-oil supplementation, no further significant differences were observed among MnSOD genotypes, demonstrating once again that its protective antioxidant effects affected the differential responses to the exercise-induced lipid peroxidation.

The CAT-21A/T polymorphism has not been associated with any alteration in catalase activity [51, 79], but individuals carrying the variant T allele presented non-significant higher HDL and lower LDL levels, both before and after pequi-oil supplementation, indicating that this variant allele could be more protective. Although there were differences in the genotype frequencies between the sexes, for clinical purposes, the reference values of lipid profile are equal for men and women [46, 67, 137], not affecting the results. However, the significant and greater increase in number of basophils after pequi-oil supplementation, which differentiated AT genotype from the other CAT genotypes, could indicate a certain predisposition of this genotype to allergic reactions related to the diet. However, this is a question that needs more investigation, mainly in view of the fact that the basophil number was still inside the reference values and all adverse effects disappeared after 3-4 days of pequi-oil treatment [88].

Glutathione S-transferases (GST) are phase II biotransformation enzymes that play an important role in the organism’s antioxidant capability, by catalyzing the conjugation of reduced GSH to a variety of endogenous and exogenous substrates [30, 36, 52]. Because GST M1 and T1 null genotypes result in a complete absence of activity in their respective enzymes [52, 68], these common deletion polymorphisms have been widely investigated for their effect on the risk of myocardial infarction [142], hypertension [80, 103], and smoking-related and non-related coronary artery disease (CAD); [1, 50, 54, 84, 130, 140]. However, these studies have yielded contradictory results, with some studies showing a significant association, and others showing no such association [140]. Nevertheless, at least in part, such contradictory results can be explained by the inter-ethnic and intra-ethnic differences known to exist in the allele frequencies of GST null genotypes [30, 36, 68]. Thus, studies mapping the distribution of these alleles’ frequency in several ethnicities can be important to gain a better understanding of their biological significance.

The GSTM1 null genotype has been associated both with a risk factor for CAD [1, 140] and with decreased risk of myocardial infarction, although the mechanisms underlying this association are still unexplained [142]. Our study corroborates the latter report and perhaps offers some explanation, given that the GSTM1 null genotype presented a downward trend in leukocyte and platelet numbers compared with the GSTM1 non-null genotypes, both before and after pequi-oil supplementation. It also presented non-significant lower TG and VLDL values, besides higher HDL and LDL values. An association between leukocytosis and increased morbidity and mortality from ischemic vascular disease has been observed for more than half a century. Leukocytosis is simply a marker of inflammation which can directly enhance acute thrombosis and chronic atherosclerosis [33]. Moreover, evidence is increasing that raised serum triglyceride levels are associated with an increased risk of atherosclerotic events [82], and VLDL is the main carrier of triglycerides in plasma [116]. In this context, results suggest that pequi oil had a beneficial effect for the GSTM1 null genotype, at least with regard to leukocytes. For the GSTT1 polymorphism, a meta-analysis of 19 studies including 8,020 cases and 11,501 controls [140] has indicated no correlation between GSTT1 null genotype and CAD risk [140]. GSTT1 null genotype has been also reported as a protective factor against CAD [50] and hypertension [80], as well as a risk factor for CAD independent of genotype-smoking interaction [1]. Our study corroborates the last of these results, given that this genotype presented a greater number of leukocytes and platelets as well as higher and significant values of TG and VLDL, mainly before pequi-oil supplementation. Because after pequi oil such differences decreased or disappeared, results suggest that pequi oil showed protective cardiovascular effects for individuals carrying GSTT1 null genotype.

The renin-angiotensin system (RAS) plays an important role in the regulation of blood pressure (BP), fluid and electrolyte homeostasis, and cardiovascular and renal pathophysiologic processes [24, 106]. For these reasons, genes coding for components of this system are attractive candidates for the investigation of the genetic basis of essential hypertension [106] and for the elucidation of the pathogenesis of CVD [25]. ACE is an important enzyme of the RAS that converts angiotensin I to angiotensin II, a potent vasoconstrictor [24, 123, 138]; since the beginning of the 1990s an association between the insertion/deletion (I/D) polymorphism of ACE gene and phenotypic expression of CVD has been reported [27]. This polymorphism has also been reported as the main determinant of plasma and tissue ACE levels [111, 138], which are highest in individuals carrying the DD genotype, lowest in those carrying II genotype, and intermediate for heterozygotes [111, 138]. The ACE D allele has been also associated with increased ACE activity [3, 133], and an increase in plasma ACE activity may increase blood pressure through increased production of angiotensin II [123]; as a result, the ACE I/D polymorphism has been associated with hypertension [10, 81, 99, 123]. However, this association is controversial and no correlation has been found in other studies [5, 32, 91, 93, 146]. In contrast, other studies suggest that ethnicity affects both ACE I/D allele frequency and the relationship between ACE I/D genotype and serum ACE concentration [47]. This suggestion reinforces the need for studies mapping the distribution of the alleles’ frequency in a number of ethnicities to gain a better understanding of their biological significance and to avoid inconsistent genotype–phenotype associations in pharmacogenetic studies. This is because the considerable range of variation in human populations may reflect, in part, distinctive processes of natural selection and adaptation to variable environmental conditions [11]. Hence, common genetic causes of hypertension for particular populations are more likely to be demonstrated than those for the general population. Although our study does not evaluate serum ACE concentration or activity, ACE I/D polymorphism significantly influenced the results of total leukocytes, segmented, total cholesterol, and LDL levels, with higher values for ID genotype. Pequi oil significantly reduced systolic pressure in athletes carrying this genotype, besides apparently canceling the pre-pequi differences between genotypes seen in the values of total leukocytes, segmented, and total cholesterol. Furthermore, the pequi supplement reduced LDL values for ID genotype, although non-significantly. These results suggest that pequi oil can potentially influence CAD and hypertension risk related to this polymorphism. In view of the fact that these are important factors which can jointly contribute to CAD risk and hypertension, our study also indicates that there are more physiologic factors related to ACE I/D polymorphism than remain to be investigated in associative studies with these diseases.

It has been reported that CK-MM polymorphism influence physiological responses to exercise [42, 56]. Although our results did not demonstrate this association with the analyzed parameters, at least for the CK-MM TaqI polymorphism, the correlation found between this polymorphism and distance covered could compromise any possible association.

CRP is an inflammatory marker that contributes to the prediction of CVD and has been associated with atherosclerosis-related phenotypes, such as measures of obesity, insulin resistance, and subclinical atherosclerosis [53, 122]. Because common genetic variants within the CRP gene have been reported to affect baseline CRP levels [8, 122], the CRP gene is an important candidate gene for atherosclerosis and some of its related phenotypes [28]. In our study, CRP and hs-CRP levels were higher for the GG genotype. However, this genotype also presented lower numbers of leukocytes, platelets, lower levels of total cholesterol, TG, and LDL, besides presenting arterial pressure below that of the GC genotype before pequi-oil supplementation. Although these differences were not significant, they were probably due to the small sample size of GC genotype. Moreover, pequi oil mainly favored the GG genotype in significantly reducing leukocytes, platelets, and systolic and diastolic pressures. In this context, our results suggest that the variant C allele could contribute to the prediction of CVD, perhaps being an independent risk factor, but this possible effect needs to be more deeply investigated. Moreover, the frequency of the C allele varies among regions [28] and possibly among ethnicities, and these are important aspects to investigate, in order to avoid spurious associations.

Increased plasma homocysteine (Hcy) is considered a risk factor for CAD [7, 15] and genetic alterations of the MTHFR enzyme could reduce its thermolability and alter the Hcy metabolism, contributing to the development of atherosclerotic lesions [15]. With this in mind, some studies have correlated the C677T and A1298C polymorphisms within MTHFR gene with elevated levels of plasma homocysteine and/or with an increased risk of CVD [21, 38, 95, 105, 129], while other studies have not found such associations [15, 59, 65, 97]. Besides other risk factors involved, ethnic and geographic variations in the allele frequencies of these polymorphisms could perhaps explain these controversial results. Before pequi-oil supplementation, our results showed significant differences in the leukogram, plateletgram, and CRP levels for the MTHFR C677T polymorphism, with increased values for T variant, corroborating results of association between this allele and CAD risk. Because after pequi there is a significant fall in the platelet number, this may indicate some protection. Results also showed significant differences for MTHFR A1298C polymorphism in the TG, VLDL, and CRP levels. However, for this polymorphism, both homozygous presented higher values than heterozygous, indicating that heterozygosis could protect against CAD, but this suggestion needs to be further investigated. After pequi-oil supplementation, there was a significant increase in CRP levels for MTHFR1298 AC genotype, but these levels remained inside the normal range, and results of leukogram, plateletgram, and lipid profile indicated protective effects of pequi.

In Brazil, there are few studies that describe these studied polymorphisms. The Brazilian population as a whole is very mixed and heterogeneous, primarily as a result of five centuries of interethnic crosses among Europeans, Africans, and Amerindians [6], and this miscegenation can influence the distribution of certain polymorphisms. The Federal District was formed in the late 1950s by a wide-ranging mixture of migrants from all regions of Brazil [108], so its population tends to reflect the constitution of the Brazilian population better than populations of other Brazilian regions.

To conclude, CAT, GST-M1/T1, CRP-G1059C, and MTHFR-C677T polymorphisms influenced pequi-oil’s responses in leukogram; Hp and MTHFR-C677T, in plateletgram; Hp, ACE, GSTT1, and MTHFR-A1298C, in lipid profile; MTHFR-A1298C, in C-reactive protein (CRP) levels; and Hp and MnSOD, in Tbars assay. Differences between ACE genotypes in the leukogram and total cholesterol disappeared after pequi, and the same occurred for Hp and MnSOD in Tbars assay and for MTHFR-A1298C with CRP levels. Genetic inheritance is one of the factors that drive the lipid abnormalities involved with the progression of atherosclerosis [64]. Consequently, our results can contribute to a greater understanding of the influence of genetic polymorphisms in situations that promote increased ROS. They may also add substantially to the knowledge of how antioxidant supplementation affects a person’s genes and how individual athletic genetic makeup can affect the way the athlete responds to antioxidant supplements.

Abbreviations

ROS: 

Reactive oxygen species

LDL: 

Low-density lipoproteins

HDL: 

High-density lipoproteins

VLDL: 

Very low-density lipoproteins

TG: 

Triglycerides

Hp: 

Haptoglobin

MnSOD: 

Manganese superoxide dismutase

CAT: 

Catalase

GPX: 

Glutathione peroxidase

CRP: 

C-reactive protein

hs-CRP: 

High-sensitivity C-reactive protein

MTHFR: 

Methylenetetrahydrofolate reductase

MPV: 

Mean platelet volume

PDW: 

Platelet distribution width

CVD: 

Cardiovascular disease

CAD: 

Coronary artery disease

CHD: 

Coronary heart disease

Declarations

Acknowledgments

The authors gratefully acknowledge the subjects who participated in this research, Sabin Institute/Sabin Laboratories and Farmacotécnica for technical support and the University of Brasília (UnB), the National Council for Technological and Scientific Development (CNPq), the Coordination for Further Training of Graduate Staff (CAPES), and the Scientific and Technological Enterprises Foundation (FINATEC) for financial support.

Conflicts of interest

Nothing to declare.

Authors’ Affiliations

(1)
Departamento de Genética e Morfologia, Laboratório de Genética, Instituto de Ciências Biológicas, Universidade de Brasília, Brasília, DF, Brazil
(2)
Laboratórios Sabin, Núcleo de Apoio à Pesquisa, Brasília, DF, Brazil

References

  1. Abu-Amero KK, Al-Boudari OM, Mohamed GH, Dzimiri N (2006) T null and M null genotypes of the glutathione S-transferase gene are risk factor for CAD independent of smoking. BMC Med Genet 7:38PubMedView ArticleGoogle Scholar
  2. Akyol O, Yanik M, Elyas H, Namli M, Canatan H, Akin H, Yuce H, Yilmaz HR, Tutkun H, Sogut S, Herken H, Özyurt H, Savas HA, Zoruglu SS (2005) Association between Ala-9-Val polymorphism of Mn-SOD gene and schizophrenia. Prog. Neuropsychopharmacol Biol Psychiatry 29:123–131View ArticleGoogle Scholar
  3. Alcantara P, Coelho C, Moreira C, Bicho M, Braz-Nogueira J (2002) Ace polymorphism and hypertensive cardiac disease. Am J Hypertens 15:156AView ArticleGoogle Scholar
  4. Alexander RW (1995) Hypertension and the pathogenesis of atherosclerosis. Hypertension 25:155–161PubMedGoogle Scholar
  5. Almada BVP, Braun V, Nassur BA, Ferreira TS, Paula F, Morelato RL (2010) Associação da hipertensão arterial com polimorfismo da enzima conversora da angiotensina em indivíduos idosos. Rev Bras Clin Med 8:320–322Google Scholar
  6. Alves-Silva J, Santos MS, Guimarães PEM, Ferreira ACS, Bandelt HJ, Pena SDJ, Prado VF (2000) The Ancestry of Brazilian mtDNA Lineages. Am J Hum Genet 67:444–461PubMedView ArticleGoogle Scholar
  7. Anderson JL, Muhlestein JB, Horne BD, Carlquist JF, Bair TL, Madsen TE, Pearson RR (2000) Plasma homocysteine predicts mortality independently of traditional risk factors and C-reactive protein in patients with angiographically defined coronary artery disease. Circulation 102:1227–1232PubMedGoogle Scholar
  8. Araújo F, Pereira AC, Mota GF, Latorre Mdo R, Krieger JE, Mansur AJ (2004) The influence of tumor necrosis factor-308 and C-reactive protein G1059C gene variants on serum concentration of C-reactive protein: evidence for an age-dependent association. Clin Chim Acta 349:129–134PubMedView ArticleGoogle Scholar
  9. Azevedo-Meleiro CH, Rodriguez-Amaya DB (2004) Confirmation of the identity of the carotenoids of tropical fruits by HPLC–DAD and HPLC–MS. J Food Compos Anal 17:385–396View ArticleGoogle Scholar
  10. Badaruddoza, Bhanwer AJS, Sawhney R, Randhawa NK, Matharoo K, Barna B (2009) A Study of angiotensin converting enzyme (ACE) gene polymorphism in essential hypertension among a business community in Punjab. Int J Hum Genet 9:231–234Google Scholar
  11. Barreiro LB, Laval G, Quach H, Patin E, Quintana-Murci L (2008) Natural selection has driven population differentiation in modern humans. Nature Genet 40:340–345PubMedView ArticleGoogle Scholar
  12. Bastaki M, Huen K, Manzanillo P, Chande N, Chen C, Balmes JR, Tager IB, Holland N (2006) Genotype–activity relationship for Mn-superoxide dismutase, glutathione peroxidase 1 and catalase in humans. Pharmacogenet Genomics 16:279–286PubMedView ArticleGoogle Scholar
  13. Beunen G, Thomis M (1999) Genetic determinants of sports participation and daily physical activity. Int J Obes 23:s55–s63View ArticleGoogle Scholar
  14. Bhatti R, Shaikh DM (2007) The effect of exercise on blood parameters. Pak J Physiol 3:42–44Google Scholar
  15. Biselli PM, Guerzoni AR, Goloni-Bertollo EM, de Godoy MF, Abou-Chahla JAB, Pavarino-Bertelli EC (2009) Variabilidade genética MTHFR no desenvolvimento da doença arterial coronária. Rev Assoc Med Bras 55:274–278PubMedView ArticleGoogle Scholar
  16. Blum S, Aviram M, Ben-Amotz A, Levy Y (2006) Effect of a Mediterranean meal on postprandial carotenoids, paraoxonase activity and C-reactive protein levels. Ann Nutr Metab 50:20–24PubMedView ArticleGoogle Scholar
  17. Borek C (2004) Antioxidants and radiation therapy. J Nutr 134:3207S–3209SGoogle Scholar
  18. Borresen AL, Leren T, Berg K, Solaas MH (1987) Effect of haptoglobin subtypes on serum lipid levels. Hum Hered 37:150–156PubMedView ArticleGoogle Scholar
  19. Bouchard C, Leon AS, Rao DC, Skinner JS, Wilmore JH, Gagnon J (1995) The HERITAGE family study. Aims, design, and measurement protocol. Med Sci Sports Exerc 27:721–729PubMedGoogle Scholar
  20. Bouchard C, Malina R, Pérusse L (1997) Genetics of fitness and physical performance. Human Kinetics, ChampaignGoogle Scholar
  21. Bova I, Chapman J, Sylantiev C, Korczyn AD, Bornstein NM (1999) The A677 V methylenetetrahydrofolate reductase gene polymorphism and carotid atherosclerosis. Stroke 30:2180–2182PubMedView ArticleGoogle Scholar
  22. Braeckman L, De Bacquer D, Delanghe J, Claeys L, De Backer G (1999) Associations between haptoglobin polymorphism, lipids, lipoproteins and inflammatory variables. Atherosclerosis 143:383–388PubMedView ArticleGoogle Scholar
  23. Brull DJ, Serrano N, Zito F, Jones L, Montgomery HE, Rumley A, Sharma P, Lowe GDO, World MJ, Humphries SE, Hingorani AD (2003) Prediction and pathogenesis of coronary heart disease human CRP gene polymorphism influences CRP levels: implications for the prediction and pathogenesis of coronary heart disease. Arterioscler Thromb Vasc Biol 23:2063–2069PubMedView ArticleGoogle Scholar
  24. Butler R (2000) The DD-ACE genotype and cardiovascular disease. Pharmacogenomics 1:153–167PubMedView ArticleGoogle Scholar
  25. Butler R, Morris AD, Struthers AD (1997) Angiotensin-converting enzyme gene polymorphism and cardiovascular disease. Clin Sci 93:391–400Google Scholar
  26. Cai H, Harrison DG (2000) Endothelial dysfunction in cardiovascular diseases: the role of oxidant stress. Circ Res 87:840–844PubMedGoogle Scholar
  27. Cambien F, Poirer O, Lecerf L, Evans A, Cambou J-P (1992) Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature 359:641–644PubMedView ArticleGoogle Scholar
  28. Cao H, Hegele RA (2000) Human C-reactive protein (CRP) 1059G/C polymorphism. J Hum Genet 45:100–101PubMedView ArticleGoogle Scholar
  29. Chen C, Liu Q, Relling MV (1996) Simultaneous characterization of glutathione S-transferase M1 and T1 polymorphisms by polymerase- chain reaction in American whites and blacks. Pharmacogenetics 6:187–191PubMedView ArticleGoogle Scholar
  30. Cho H-J, Lee S-Y, Ki C-S, Kim J-W (2005) GSTM1, GSTT1 and GSTP1 polymorphisms in the Korean population. J Korean Med Sci 20:1089–1092PubMedView ArticleGoogle Scholar
  31. Choi JY, Neuhouser ML, Barnett MJ, Hong CC, Kristal AR, Thornquist MD, King IB, Goodman GE, Ambrosone CB (2008) Iron intake, oxidative stress-related genes (MnSOD and MPO) and prostate cancer risk in CARET cohort. Carcinogenesis 29:964–970PubMedView ArticleGoogle Scholar
  32. Chowdhury AH, Zaman MM, Haque KM, Rouf MA, Shah AT, Nakayama T, Yokoyama T, Yoshiike N, Tanaka H (1998) Association of angiotensin converting enzyme (ACE) gene polymorphism with hypertension in a Bangladeshi population. Bangladesh Med Res Counc Bull 24:55–59PubMedGoogle Scholar
  33. Coller BS (2005) Leukocytosis and ischemic vascular disease morbidity and mortality: is it time to intervene? Arterioscler Thromb Vasc Biol 25:658–670PubMedView ArticleGoogle Scholar
  34. Cortese C, Motti C (2001) MTHFR gene polymorphism, homocysteine and cardiovascular Disease. Public Health Nutr 4:493–497PubMedView ArticleGoogle Scholar
  35. Costa Rosa LFPB, Vaisberg MW (2002) Influências do exercício na resposta imune. Rev Bras Med Esporte 8:167–172View ArticleGoogle Scholar
  36. Cotton SC, Sharp L, Little J, Brackton N (2000) Glutathione S-transferase polymorphisms and colorectal cancer: a HuGE Review. Am J Epidemiol 151:7–32PubMedGoogle Scholar
  37. Cruzat VF, Rogero MM, Borges MC, Tirapegui J (2007) Aspectos atuais sobre estresse oxidativo, exercícios físicos e suplementação. Rev Bras Med Esp 13:336–342View ArticleGoogle Scholar
  38. Dedoussis GV, Panagiotakos DB, Pitsavos C, Chrysohoou C, Skoumas J, Choumerianou D, Stefanadis C, Study Group ATTICA (2005) An association between the methylenetetrahydrofolate reductase (MTHFR) C677T mutation and inflammation markers related to cardiovascular disease. Int J Cardiol 100:409–414PubMedView ArticleGoogle Scholar
  39. Delanghe JR, Duprez DA, De Buyzere ML, Bergez BM, Claeys LR, Leroux-Roels GG, Clement DL (1995) Refractory hypertension is associated with the haptoglobin 2–2 phenotype. J Cardiovasc Risk 2:131–136PubMedView ArticleGoogle Scholar
  40. Delanghe J, Cambier B, Langlois M, De Buyzere M, Neels H, De Bacquer D, Van Cauwelaert P (1997) Haptoglobin polymorphism, a genetic risk factor in coronary artery bypass surgery. Atherosclerosis 132:215–219PubMedView ArticleGoogle Scholar
  41. Desgorces FD, Testa M, Petibois C (2008) Training-level induced changes in blood parameters response to on-water rowing races. J Sports Sci Med 7:425–430Google Scholar
  42. Dias RG, Pereira AC, Negrão CE, Krieger JE (2007) Genetic polymorphisms determining of the physical performance in elite athletes. Rev Bras Med Esporte 13(3):186e–192eGoogle Scholar
  43. Ferreira ALA, Matsubara LS (1997) Radicais livres: conceitos, doenças relacionadas, sistema de defesa e estresse oxidativo. Rev Assoc Med Bras 43:61–68PubMedGoogle Scholar
  44. Ferreira F, Ferreira R, Duarte JA (2007) Stress oxidativo e dano oxidativo muscular esquelético: influência do exercício agudo inabitual e do treino físico. Rev Port Cien Desp 7:257–275Google Scholar
  45. Forsberg L, Faire U, Morgenstern R (2001) Oxidative stress, human genetic variation, and disease. Arch Biochem Biophys 389:84–93PubMedView ArticleGoogle Scholar
  46. Freire LMD, Sodré FL, Oliveira RA, Castilho LN, Faria EC (2008) Controle de qualidade laboratorial pré-analítico: avaliação de solicitações médicas de exames bioquímicos no Hospital de Clínicas da Universidade Estadual de Campinas, São Paulo, Brasil. RBAC 40(2):143–145Google Scholar
  47. Gainer JV, Stein CM, Neal T, Vaughan DE, Brown NJ (2001) Interactive Effect of Ethnicity and ACE Insertion/Deletion Polymorphism on Vascular Reactivity. Hypertension 37:46–51PubMedGoogle Scholar
  48. Gill MR, Hardman AE (2000) Postprandial lipemia: effects of exercise and restriction of energy intake compared. Am J Clin Nutr 71:465–471PubMedGoogle Scholar
  49. Gill-Garrison R (2007) Nutrigenomics: Genetics in Dietary Prescription: 116: 4:00 PM–4:30 PM. Med Sci Sports Exer 39:41Google Scholar
  50. Girisha KM, Gilmour A, Mastana S, Singh VP, Sinha N, Tewari S, Ramesh V, Sankar VH, Agrawal S (2004) T1 and M1 polymorphism in glutathione S-transferase gene and coronary artery disease in North Indian population. Indian J Med Sci 58:520–526PubMedGoogle Scholar
  51. Góth L, Rass P, Páy A (2004) Catalase enzyme mutations and their association with diseases. Mol Diagn 8:141–149PubMedView ArticleGoogle Scholar
  52. Goulas A, Kosmidou M, Hatzitolios AI, Molyva D, Fidani L, Giannopoulos S, Mirtsou V (2008) Glutathione S-transferase null and cholesteryl ester transfer protein TaqI B polymorphisms and lipid response to atorvastatin in Greek dyslipidaemic patients. Basic Clin Pharmacol Toxicol 102:559–562PubMedView ArticleGoogle Scholar
  53. Hak AE, Stehouwer CD, Bots ML, Polderman KH, Schalkwijk CG, Westendorp IC, Hofman A, Witteman JC (1999) Associations of C-reactive protein with measures of obesity, insulin resistance, and subclinical atherosclerosis in healthy, middle-aged women. Arterioscler Thromb Vasc Biol 19:1986–1991PubMedView ArticleGoogle Scholar
  54. Hayek T, Stephens JW, Hubbart CS, Acharya J, Caslake MJ, Hawe E, Miller GJ, Hurel SJ, Humphries SE (2006) A common variant in the glutathione S transferase gene is associated with elevated markers of inflammation and lipid peroxidation in subjects with diabetes mellitus. Atherosclerosis 184:404–412PubMedView ArticleGoogle Scholar
  55. Hayes JD, Strange RC (2000) Glutathione S-transferase polymorphisms and their biological consequences. Pharmacology 61:154–166PubMedView ArticleGoogle Scholar
  56. Heled Y, Bloom MS, Wu TJ, Stephens Q, Deuster PA (2007) CM-MM and ACE genotypes and physiological prediction of the creatine kinase response to exercise. J Appl Physiol 103:504–510PubMedView ArticleGoogle Scholar
  57. Hermes-Lima M (2004) Oxygen in biology and biochemistry: role of free radicals. In: Storey KB (ed) Functional metabolism: regulation and adaptation. Hoboken, New Jersey, pp 319–368Google Scholar
  58. Hiragi CA, Miranda-Vilela AL, Rocha DMS, Oliveira SF, Hatagima A, Klautau-Guimarães MN (2011) Superoxide dismutase, catalase, glutathione peroxidase and gluthatione S-transferases M1 and T1 gene polymorphisms in three Brazilian population groups. Genet Mol Biol 34(1):11–18Google Scholar
  59. Houcher B, Houcher Z, Touabti A, Begag S, Torun D, Egin Y, Akar N, Kadour F (2010) Association of Methylenetetrahydrofolate reductase C677T and cystathionine β-synthase polymorphisms in cardiovascular disease in the Algerian population. Genet Test Mol Biomarkers 14:1–6View ArticleGoogle Scholar
  60. Hu G, Salem MR, Crystal GJ (2005) Isoflurane prevents platelets from enhancing neutrophil-induced coronary endothelial dysfunction. Anesth Analg 101:1261–1268PubMedView ArticleGoogle Scholar
  61. Ji LL, Leichtweis S (1997) Exercise and oxidative stress: sources of free radicals and their impact on antioxidant systems. Age 20:91–106View ArticleGoogle Scholar
  62. Kang SS, Wong PW, Susmano A, Sora J, Norusis M, Ruggie N (1991) Thermolabile methylenetetrahydrofolate reductase: an inherited risk factor for coronary artery disease. Am J Hum Genet 48:536–645PubMedGoogle Scholar
  63. Kaput J, Rodriguez RL (2004) Nutritional genomics: the next frontier in the postgenomic era. Physiol Genomics 16:166–177PubMedGoogle Scholar
  64. Kiechl S, Willeit J, Mayr M, Viehweider B, Oberhollenzer M, Kronenberg F, Wiedermann CJ, Oberthaler S, Xu Q, Witztum JL, Tsimikas S (2007) Oxidized phospholipids, lipoprotein(a), lipoprotein-associated phospholipase A2 activity, and 10-year cardiovascular outcomes: prospective results from the Bruneck study. Arterioscler Thromb Vasc Biol 27:1788–1795PubMedView ArticleGoogle Scholar
  65. Kölling K, Ndrepepa G, Koch W, Braun S, Mehilli J, Schömig A, Kastrati A (2004) Methylenetetrahydrofolate reductase gene C677T and A1298C polymorphisms, plasma homocysteine, folate, and vitamin B12 levels and the extent of coronary artery disease. Am J Cardiol 93:1201–1206PubMedView ArticleGoogle Scholar
  66. Kolovou GD, Anagnostopoulou KK, Pavlidis AN, Salpea KD, Iraklianou SA, Tsarpalis K, Damaskos DS, Manolis A, Cokkinos DV (2005) Postprandial lipemia in men with metabolic syndrome, hypertensives and healthy subjects. Lipids Health Dis 4:21PubMedView ArticleGoogle Scholar
  67. Kratz A, Ferraro M, Sluss PM, Lewandrowski KB (2004) Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Laboratory reference values. N Engl J Med 351(15):1548–1563PubMedView ArticleGoogle Scholar
  68. Landi S (2000) Mammalian class theta GST and differential susceptibility to carcinogenesis: a review. Mutat Res 463:247–283PubMedView ArticleGoogle Scholar
  69. Langlois MR, Delanghe JR (1996) Biological and clinical significance of haptoglobin polymorphism in humans. Clin Chem 42:1589–1600PubMedGoogle Scholar
  70. Laufs U, Wassmann S, Czech T, Münzel T, Eisenhauer M, Böhm M, Nickenig G (2005) Physical inactivity increases oxidative stress, endothelial dysfunction, and atherosclerosis. Arterioscler Thromb Vasc Biol 25:809–814PubMedView ArticleGoogle Scholar
  71. Leandro C, Nascimento E, Manhães-de-Castro R, Duarte JA, de-Castro CMMB (2002) Exercício físico e sistema imunológico: mecanismos e integrações. Rev Port Cien Desp 2:80–90Google Scholar
  72. Lecarpentier Y (2007) Physiological role of free radicals in skeletal muscles. J Appl Physiol 103:1917–1918PubMedView ArticleGoogle Scholar
  73. Levy AP, Hochberg I, Jablonski K, Resnick HE, Lee ET, Best L, Howard BV, Study StrongHeart (2002) Haptoglobin phenotype is an independent risk factor for cardiovascular disease in individuals with diabetes: the strong heart study. J Am Coll Cardiol 40:1984–1990PubMedView ArticleGoogle Scholar
  74. Li JJ, Chen JL (2005) Inflammation may be a bridge connecting hypertension and atherosclerosis. Med Hypotheses 64:925–929PubMedView ArticleGoogle Scholar
  75. Lima A, Silva AMO, Trindade RA, Torres RP, Mancini-Filho J (2007) Composição química e compostos bioativos presentes na polpa e na amêndoa do pequi (Caryocar brasiliense Camb.). Rev Bras Frutic 29:695–698View ArticleGoogle Scholar
  76. Lippi G, Longo UG, Maffulli N (2010) Genetics and sports. Br Med Bull 93:27–47PubMedView ArticleGoogle Scholar
  77. López S, Bermúdez B, Pacheco YM, López-Lluch G, Moreda W, Villar J, Abia R, Muriana FJG (2007) Dietary oleic and palmitic acids modulate the ratio of triacylglycerols to cholesterol in postprandial triacylglycerol-rich lipoproteins in men and cell viability and cycling in human monocytes. J Nutr 137:1999–2005PubMedGoogle Scholar
  78. MacArthur DG, North KN (2005) Genes and human elite athletic performance. Hum Genet 116:331–339PubMedView ArticleGoogle Scholar
  79. Mak JCW, Leung HCM, Ho SP, Ko FW, Cheung AH, Ip MS, Chan-Yeung MM (2006) Polymorphisms in manganese superoxide dismutase and catalase genes: functional study in Hong Kong Chinese asthma patients. Clin Exp Allergy 36:440–447PubMedView ArticleGoogle Scholar
  80. Marinho C, Alho I, Arduino D, Falcao LM, Bras-Nogueira J, Bicho M (2007) GST M1/T1 and MTHFR polymorphisms as risk factors for hypertension. Biochem Biophys Res Commun 353:344–350PubMedView ArticleGoogle Scholar
  81. Matsubara M (2000) Genetic determination of human essential hypertension. Tohoku J Exp Med 192:19–33PubMedView ArticleGoogle Scholar
  82. McBride PE (2007) Triglycerides and risk for coronary heart disease. JAMA 298:336–338PubMedView ArticleGoogle Scholar
  83. Mertens A, Holvoet P (2001) Oxidized LDL and HDL: antagonists in atherothrombosis. FASEB J 15:2073–2084PubMedView ArticleGoogle Scholar
  84. Miller EA, Pankow JS, Millikan RC, Bray MS, Ballantyne CM, Bell DA, Heiss G, Li R (2003) Glutathione-S-transferase genotypes, smoking, and their association with markers of inflammation, hemostasis, and endothelial function: the atherosclerosis risk in communities (ARIC) study. Atherosclerosis 171:265–272Google Scholar
  85. Miller DT, Zee RY, Suk DJ, Kozlowski P, Chasman DI, Lazarus R, Cook NR, Ridker PM, Kwiatkowski DJ (2005) Association of common CRP gene variants with CRP levels and cardiovascular events. Ann Hum Genet 69:623–638PubMedView ArticleGoogle Scholar
  86. Mineo C, Deguchi H, Griffin JH, Shaul PW (2006) Endothelial and antithrombotic actions of HDL. Circ Res 98:1352–1364PubMedView ArticleGoogle Scholar
  87. Miranda-Vilela AL, Resck IS, Grisolia CK (2008) Antigenotoxic activity and antioxidant properties of organic and aqueous extracts of pequi fruit (Caryocar brasiliense Camb.) pulp. Genet Mol Biol 31:956–963View ArticleGoogle Scholar
  88. Miranda-Vilela AL, Akimoto AK, Alves PCZ, Pereira LCS, Gonçalves CA, Klautau-Guimarães MN, Grisolia CK (2009) Dietary carotenoid-rich pequi oil reduces plasma lipid peroxidation and DNA damage in runners and evidence for an association with MnSOD genetic variant—Val9Ala. Genet Mol Res 8:481–1495View ArticleGoogle Scholar
  89. Miranda-Vilela AL, Resck IS, Mendonça MA, Grisolia CK (2009) Characterization of the major nutritional components of Caryocar brasiliense fruit pulp by NMR spectroscopy. Quim Nova 32:2310–2313View ArticleGoogle Scholar
  90. Miranda-Vilela AL, Pereira LCS, Gonçalves CA, Grisolia CK (2009) Pequi fruit (Caryocar brasiliense Camb.) pulp oil reduces exercise-induced inflammatory markers and blood pressure of male and female runners. Nutr Res 29:850–858PubMedView ArticleGoogle Scholar
  91. Miranda-Vilela AL, Akimoto AK, Alves PCZ, Ferreira LB, Lordelo GS, Melo JGM, Grisolia CK, Oliveira SF, Klautau-Guimarães MN (2010) Evidence for an association between haptoglobin and MnSOD (Val9Ala) gene polymorphisms in essential hypertension based on a Brazilian case–control study. Genet Mol Res 9:2166–2175PubMedView ArticleGoogle Scholar
  92. Miranda-Vilela AL, Akimoto AK, Alves PCZ, Pereira LCS, Klautau-Guimarães MN, Grisolia CK (2010) Dietary carotenoid-rich oil supplementation improves exercise-induced anisocytosis in runners: influences of haptoglobin, MnSOD (Val9Ala), CAT (21A/T) and GPX1 (Pro198Leu) gene polymorphisms in dilutional pseudoanemia (“sports anemia”). Genet Mol Biol 33:359–367PubMedView ArticleGoogle Scholar
  93. Miranda-Vilela AL, Alves PCZ, Akimoto AK, Lordelo GS, Gonçalves CA, Grisolia CK, Klautau-Guimarães MN (2010) Gene polymorphisms against DNA damage induced by hydrogen peroxide in leukocytes of healthy humans through comet assay: a quasi-experimental study. Environ Health 9:21PubMedView ArticleGoogle Scholar
  94. Mitrunen K, Sillanpaa P, Kataja V, Eskelinen M, Kosma VM, Benhamou S, Uusitupa M, Hirvonen A (2001) Association between manganese superoxide dismutase (MnSOD) gene polymorphism and breast cancer risk. Carcinogenesis 22:827–829PubMedView ArticleGoogle Scholar
  95. Morita H, Taguchi J, Kurihara H, Kitaoka M, Kaneda H, Kurihara Y, Maemura K, Shindo T, Minamino T, Ohno M, Yamaoki K, Ogasawara K, Aizawa T, Suzuki S, Yazaki Y (1997) Gene polymorphism of 5, 10-methylenetetrahydrofolate reductase as a coronary risk factor. J Cardiol 29:309–315PubMedGoogle Scholar
  96. Mougios V (2007) Reference intervals for serum creatine kinase in athletes. Br J Sports Med 41(10):674–678PubMedView ArticleGoogle Scholar
  97. Muniz MTC, Siqueira ERF, Fonseca RA, D’Almeida V, Hotta JK, Santos JE, Cavalcanti MSM, Sampaio CAM (2006) Avaliação da relação entre o polimorfismo C677T no gene para MTHFR e a concentração plamática de homocisteína na doença arterial coronariana. Arq Bras Endocrinol Metab 50:1059–1065View ArticleGoogle Scholar
  98. Nakazono K, Watanabe N, Matsuno K, Sasaki J, Sato T, Inoue M (1991) Does superoxide underlie the pathogenesis of hypertension? Proc Natl Acad Sci 88:10045–10048PubMedView ArticleGoogle Scholar
  99. O’Donell CJ, Lindpainter K, Larson MG, Rao VS, Ordovas JM, Schaefer EJ, Mayers RH, Levy D (1998) Evidence for association and genetic linkage of the angiotensin-converting enzyme locus with hypertension and blood pressure in men but not women in the Framingham heart study. Circulation 97:1766–1772Google Scholar
  100. Odawara M, Matsunuma A, Yamashita K (1997) Mistyping frequency of the angiotensin-converting enzyme gene polymorphism and an improved method for its avoidance. Hum Genet 100:163–166PubMedView ArticleGoogle Scholar
  101. Oliveira MNS, Gusmão E, Lopes PSN, Simões MOM, Ribeiro LMD, Souto BA (2006) Estádio de maturação dos frutos e fatores relacionados aos aspectos nutritivos e de textura da polpa de pequi (Caryocar brasiliense Camb.). Rev Bras Frutic 28:380–386View ArticleGoogle Scholar
  102. Olson SH, Carlson MDA, Ostrer H, Harlap S, Stone A, Winters M, Ambrosone CB (2004) Genetic variants in SOD2, MPO, and NQO1, and risk of ovarian cancer. Gynecol Oncol 93:615–620PubMedView ArticleGoogle Scholar
  103. Oniki K (2008) Association between glutathione S-transferase A1, M1 and T1 polymorphisms and hypertension. Pharmacogenet Genomics 18:275–277PubMedView ArticleGoogle Scholar
  104. Pacheco YM, Bermúdez B, López S, Abia R, Villar J, Muriana FJ (2006) Ratio of oleic to palmitic acid is a dietary determinant of thrombogenic and fibrinolytic factors during the postprandial state in men. Am J Clin Nutr 84(2):342–349PubMedGoogle Scholar
  105. Payne DA, Chamoun AJ, Seifert SI, Stouffer GA (2001) MTHFR677C → T mutation: a predictor of early-onset coronary artery disease. Thromb Res 103:275–279PubMedView ArticleGoogle Scholar
  106. Perticone F, Ceravolo R, Maio R, Ventura G, Zingone A, Perrotti N, Mattioli PL (1998) Angiotensin-converting enzyme gene polymorphism is associated with endothelium-dependent vasodilation in never treated hypertensive patients. Hypertension 31:900–905PubMedGoogle Scholar
  107. Prabha S, Padma T, Ramaswamy M (1987) Haptoglobin patterns in essential hypertension and associated conditions—increased risk for Hp 2–2. Hum Hered 37:345–348View ArticleGoogle Scholar
  108. Queiroz EP (2006) A migração intrametropolitana no Distrito Federal e Entorno: o consequente fluxo pendular e o uso dos equipamentos urbanos de saúde e educação. XV Encontro Nacional de Estudos Populacionais, ABEP. http://www.abep.nepo.unicamp.br/encontro2006/docspdf/ABEP2006_724.pdf. Accessed 26 October 2010
  109. Radak Z, Kumagai S, Nakamoto H, Asto S (2007) 8-Oxoguanosine and uracil repair of nuclear and mitochondrial DNA in red and white skeletal muscle of exercise-trained old rats. J Appl Physiol 102:1696–1701PubMedView ArticleGoogle Scholar
  110. Ramos MIL, Umaki MCS, Hiane PA, Ramos-Filho MM (2001) Efeito do cozimento convencional sobre os carotenóides pró-vitamínicos “A” da polpa de pequi (Caryocar brasiliense Camb.). Bol Centro Pesqui Process Aliment 19:23–32Google Scholar
  111. Rigat B, Hubert C, Alhene-Gelas F, Cambien F, Corvol P, Sourbrier F (1990) An insertion/deletion polymorphism in the angiotensin I converting enzyme gene accounts for half the variance of serum enzyme levels. J Clin Invest 86:1343–1346PubMedView ArticleGoogle Scholar
  112. Rigat B, Hubert C, Corvol P, Soubrier F (1992) PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res 20:1433PubMedView ArticleGoogle Scholar
  113. Rivera MA, Dionne FT, Wolfarth B, Chagnon M, Simoneau J-A, Pérusse L, Boulay MR, Gagnon J, Song TMK, Keul J, Bouchard C (1997) Muscle-specific creatine kinase gene polymorphisms in elite endurance athletes and sedentary controls. Med Sci Sports Exerc 29:1444–1447PubMedView ArticleGoogle Scholar
  114. Roguin A, Koch W, Kastrati A, Aronson D, Schomig A, Levy AP (2003) Haptoglobin genotype is predictive of major adverse cardiac events in the 1-year period after percutaneous transluminal coronary angioplasty in individuals with diabetes. Diabetes Care 26:2628–2631PubMedView ArticleGoogle Scholar
  115. Rosenson RS, Lowe GDO (1998) Effects of lipids and lipoproteins on thrombosis and rheology. Atherosclerosis 140:271–280PubMedView ArticleGoogle Scholar
  116. Sacks FM, Alaupovic P, Moye LA, Cole TG, Sussex B, Stampfer MJ, Pfeffer MA, Braunwald E (2000) VLDL, apolipoproteins B, CIII, and E, and risk of recurrent coronary events in the cholesterol and recurrent events (CARE) trial. Circulation 102:1886–1892PubMedGoogle Scholar
  117. Santos ME, Galvão T, Oliveira ALM (2008) Tamanho de Plaquetas e Doença vascular. NewsLab 87:70–76Google Scholar
  118. Santos-Silva A, Rebelo MI, Castro EM, Belo L, Guerra A, Rego C, Quintanilha A (2001) Leukocyte activation, erythrocyte damage, lipid profile and oxidative stress imposed by high competition physical exercise in adolescents. Clin Chim Acta 306:119–126PubMedView ArticleGoogle Scholar
  119. Schneider CD, Oliveira AR (2004) Radicais livres de oxigênio e exercício: mecanismos de formação e adaptação ao treinamento físico. Rev Bras Med Esporte 10:1–6Google Scholar
  120. Schumann G, Klauke R (2003) New IFCC reference procedures for the determination of catalytic activity concentrations of five enzymes in serum: preliminary upper reference limits obtained in hospitalized subjects. Clin Chim Acta 327:69–79PubMedView ArticleGoogle Scholar
  121. Serre D, Hudson TJ (2006) Resources for genetic variation studies. Annu Rev Genomics Hum Genet 7:443–457PubMedView ArticleGoogle Scholar
  122. Shen J, Arnett DK, Parnell LD, Peacock JM, Lai CQ, Hixson JE, Tsai MY, Province MA, Straka RJ, Ordovas JM (2008) Association of common C-reactive protein (CRP) gene polymorphisms with baseline plasma CRP levels and fenofibrate response: the GOLDN study. Diabetes Care 31(5):910–915PubMedView ArticleGoogle Scholar
  123. Sipahi T, Budak M, Şen S, Ay A, Şener S (2006) Association between ace gene insertion (i)/deletion (d) polymorphism and primary hypertension in Turkish patients of Trakya region. Biotechnol Biotechnol Eq 20:104–108Google Scholar
  124. Smith DJ (2003) A framework for understanding the training process leading to elite performance. Sports Med 33:1103–1126PubMedView ArticleGoogle Scholar
  125. Soriguer F, Rojo-Martínez G, Dobarganes MC, Almeida JMG, Esteva I, Beltrán M, De Adana MSR, Tinahones F, Gómez-Zumaquero JM, García-Fuentes E, González-Romero S (2003) Hypertension is related to the degradation of dietary frying oils. Am J Clin Nutr 78:1092–1097PubMedGoogle Scholar
  126. Stover PJ (2004) Nutritional genomics. Physiol Genomics 16:161–165PubMedGoogle Scholar
  127. Suk HJ, Ridker PM, Cook NR, Zee RYL (2005) Relation of polymorphism within the C-reactive protein gene and plasma CRP levels. Atherosclerosis 178:139–145PubMedView ArticleGoogle Scholar
  128. Sureda A, Tauler P, Aguiló A, Cases N, Fuentespina E, Córdova A, Tur JA, Pons A (2005) Relation between oxidative stress markers and antioxidant endogenous defences during exhaustive exercise. Free Rad Res 39:317–1324View ArticleGoogle Scholar
  129. Szczeklik A, Sanak M, Jankowski M, Dropiński J, Czachór R, Musiał J, Axenti I, Twardowska M, Brzostek T, Tendera M (2001) Mutation A1298C of methylenetetrahydrofolate reductase: risk for early coronary disease not associated with hyperhomocysteinemia. Am J Med Genet 101:36–39PubMedView ArticleGoogle Scholar
  130. Tamer L, Ercan B, Camsari A, Yildirim H, Ciçek D, Sucu N, Ateş NA, Atik U (2004) Glutathione S-transferase gene polymorphism as a susceptibility factor in smoking-related coronary artery disease. Basic Res Cardiol 99:223–229PubMedView ArticleGoogle Scholar
  131. Thompson PD, Franklin BA, Balady GJ, Blair SN, Corrado D, Estes NAM, Fulton JE, Gordon N, Haskell WL, Link MS, Maron BJ, Mittleman MA, Pelliccia A, Wenger NK, Willich SN, Costa F (2007) Exercise and acute cardiovascular events. Circulation 115:2358–2368PubMedView ArticleGoogle Scholar
  132. Traber MG (2006) Relationship of vitamin E metabolism and oxidation in exercising human subjects. Br J Nutr 96:S34–S37PubMedView ArticleGoogle Scholar
  133. Ueda S, Elliott HL, Morton JJ, Connell JM (1995) Enhanced pressor response to angiotensin I in normotensive men with the deletion genotype (DD) for angiotensin-converting enzyme. Hypertension 25:1266–1269PubMedGoogle Scholar
  134. Ukkola O, Erkkilä PH, Savolainen MJ, Kesäniemi YA (2001) Lack of association between polymorphisms of catalase, copper/zinc superoxide dismutase (SOD), extracellular SOD and endothelial nitric oxide synthase genes and macroangiopathy in patients with type 2 diabetes mellitus. J Intern Med 249:451–459PubMedView ArticleGoogle Scholar
  135. Urhausen A, Gabriel H, Kindermann W (1995) Blood hormones as markers of training stress and overtraining. Sports Med 20:251–276PubMedView ArticleGoogle Scholar
  136. Urso ML, Clarkson PM (2003) Oxidative stress, exercise, and antioxidant supplementation. Toxicology 189:41–54PubMedView ArticleGoogle Scholar
  137. Van den Bossche J, Devreese K, Malfait R, Van de Vyvere M, Wauters A, Neeis H, De Schouwer P (2002) Reference intervals for a complete blood count determined on different automated haematology analysers: Abx Pentra 120 Retic, Coulter Gen-S, Sysmex SE 9500, Abbott Cell Dyn 4000 and Bayer Advia 120. Clin Chem Lab Med 40(1):69–73PubMedView ArticleGoogle Scholar
  138. van der Kleij FG, de Jong PE, Henning RH, de Zeeuw D, Navis G (2002) Enhanced responses of blood pressure, renal function, and aldosterone to angiotensin I in the DD genotype are blunted by low sodium intake. J Am Soc Nephrol 13:1025–1033PubMedGoogle Scholar
  139. Vatansev H, Çakmakçi E (2010) The effects of 8-week aerobic exercises on the blood lipid and body composition of the owerweight and obese females. Ovidius Univ Ann Phys Educ Sport Sci Movem Health 2:814–820Google Scholar
  140. Wang J, Zou LJ, Huang SD, Lu FL, Lang XL, Han L, Song ZG, Xu ZY (2010) Genetic polymorphisms of glutathione. Mutagenesis 25:365–369PubMedView ArticleGoogle Scholar
  141. Wasowicz W, Nève J, Peretz A (1993) Optimized steps in fluorometric determination of thiobarbituric acid-reactive substances in serum: importance of extraction pH and influence of sample preservation and storage. Clin Chem 39:2522–2526PubMedGoogle Scholar
  142. Wilson MH, Grant PJ, Hardie LJ, Wild CP (2000) Glutathione S-transferase M1 null genotype is associated with a decreased risk of myocardial infarction. FASEB J 14:791–796PubMedGoogle Scholar
  143. Yano A, Yamamoto Y, Miyaishi S, Ishizu H (1998) Haptoglobin genotyping by allele-specific polymerase chain reaction amplification. Acta Med 52:173–181Google Scholar
  144. Yfanti C, Akerström T, Nielsen S, Nielsen AR, Mounier R, Mortensen OH, Lykkesfeldt J, Rose AJ, Fischer CP, Pedersen BK (2010) Antioxidant supplementation does not alter endurance training adaptation. Med Sci Sports Exerc 42:1388–1395PubMedGoogle Scholar
  145. Yi P, Pogribny IP, James SJ (2002) Multiplex PCR for simultaneous detection of 677 C → T and 1298 A → C polymorphisms in methylenetetrahydrofolate reductase gene for population studies of cancer risk. Cancer Letter 181:209–213View ArticleGoogle Scholar
  146. Zaman MM, Yoshiike N, Date C, Yokoyama T, Matsumura Y, Ikemoto S, Tanaka H (2001) Angiotensin converting enzyme genetic polymorphism is not associated with hypertension in a cross-sectional sample of a Japanese population: the Shibata study. J Hypertens 19:47–53PubMedView ArticleGoogle Scholar
  147. Zhao H, Liang D, Grossman HB, Wu X (2005) Glutathione peroxidase 1 gene polymorphism and risk of recurrence in patients with superficial bladder cancer. Urology 66:769–774PubMedView ArticleGoogle Scholar
  148. Zhou DQ, Hu Y, Liu G, Wu J, Gong L (2005) An A/G polymorphism in muscle-specific creatine kinase gene in Han population in northern China. Yi Chuan 27:535–538PubMedGoogle Scholar
  149. Zhou DQ, Hu Y, Liu G, Gong L, Xi Y, Wen L (2006) Muscle-specific creatine kinase gene polymorphism and running economy responses to an 18-week 5000-m training programme. Br J Sports Med 40:988–991PubMedView ArticleGoogle Scholar

Copyright

© Springer-Verlag 2011

Advertisement